Countdown; Earth, 204 N.E.

Physician, heal thyself.
--Luke iv, 23

The snake eats itself, the dog chases its tail.
--G. Spencer Brown, Laws of Form


"Can you go home?" Susan had asked him, and in his profound hangover he'd
profoundly misunderstood her. What she'd wanted to know was whether he was
awake, and strong enough, and steady enough, to walk out of her life. Preferably
forever. It was not a friendly question.
But he'd taken it metaphysically, and for a moment his foggy brain had wrestled
with possibilities. Could he go home again? What would he do differently, if
suddenly he were given the chance to do it all over?
'Take these," she'd said, thrusting a triad of pills at his face. His half open
eyes had recognized a battery of lipotro-pin derivatives: energy, good will, a
sense of well-being, waiting under bis nose. The clouds of depression would
lift, the sun would come out, the bluebird of happiness would sing.
He'd shifted bis gaze to the gray-brown San Francisco fog outside Susan's soleri
window. Lying on his back on her couch, looking straight up, be couldn't see
anything else. Cold poisonous tentacles of despair, coiling over the glass half
dome. And inside bis skin, it was worse: he could smell the dried sweat and the
vomit, taste the congealed mucus on his tongue. Oh, he'd been a very naughty boy
this time....
"Come on, Phil, take it and get out of here. Chemical sympathy is all you get.
I've got work to do." -
He'd taken the pills, dreading the memories they would restore. Then Susan had
hauled him off the couch and pushed him through the door.
Those were his first wobbly steps on the way home.
Stage One; from Earth to Darwin, 206 N.E.--and before
Humboldt drove upward into star-spangled space, balanced on a column of fire
from her annihilator engines. All her crystal promenades and portals were
ablaze. On this "night" (by the ship's clock) the regal liner was more than
three months from Earth, and only hours from Earth Station, the binary black
hole system that gave forth on all the known accessible worlds of the Starry
Archipelago.
Barring some unimaginable last minute emergency, Humboldt would proceed
unchecked, diving with headlong grace into the space-time vortex around the
orbiting holes, to emerge in no time in the vicinity of Darwin's Star a few
dozen light-years away. The passage of the holes was scheduled for three o'clock
in the morning, ship's time; before then there would not be the slightest
interruption in the smooth .8-gee acceleration Humboldt maintained for the
comfort of her passengers.
Those passengers gathered now by twos and threes and fours, to recline in
leather-cushioned luxury beneath the sunset desert sky and battlemented mud
walls of ancient Timbuktu. Palm fronds rattled in the cool breeze from the air
conditioners. Boredom alone would have brought them to tonight's lecture in the
Sun Grove lounge; that it was to be delivered by Philip Holder insured a full
turnout.
Now if only Phil himself would turn out, fretted Evan Bruneau, Humboldt's
sensie-handsome young Third Officer. He smiled warmly at Vivee Chillingsworth,
and her diamonds, and her escort Robby Fain. Fain winked at Bruneau as he
steered the widow Chillingsworth under the grape arbor and into the lounge, but
Bruneau knew that Robby was only teasing.
Bruneau was beginning to fear the worst; the good doctor Holder was very
distinguished indeed, but more often these past couple of years for his epic
binges than for his contributions to the annals of medicine.
Not that Bruneau was a moralist. His major task was to keep Humboldts passengers
entertained on the ship's long, long voyages among the major ports of the
Archipelago, and Holder, a frequent passenger, was an invaluable resource: he
had an intimate knowledge of the cultures of the inhabited worlds, gained
through years of research, and he was an incurable raconteur. In return for
Holder's services as a lecturer, Bruneau was happy to cancel his bar tabs.
It was after 21:00 already. If Holder didn't show up in a couple of minutes,
Bruneau would have to send a steward around to the bars (Humboldt had eight).
And if Holder wasn't in one of them, Bruneau would be forced to admit defeat.
He'd show the travelogue sensie instead, and bis name would be mud.
Of course he'd know damn well where Holder was. That was another part of then-
unspoken arrangement: Holder took his pounds of flesh (all female, mostly
young), and somehow Bruneau managed never to think of the introductions he
arranged as pimping. Perhaps that was unfortunate-- in the present case it left
him no excuse to go rousting one guest out of another's bed. (Excuse me, Loa
darling, but Phil promised...)
But here came Loa Westcliffe now, fully dressed In diaphanous jumper, and all
alone.
Bruneau grinned with relief. "So nice to see you here, Loa darling."
"Where the hell else would I be, dear?" Westcliffe asked, tossing metallic green
locks. "Phil show up yet?"
"I couldn't say, really, I just..."
"In other words, no. If I were you I'd run quick as a bunny down to the Mirror
Room and fish him out of his martini, or you're not going to have a show
tonight." Her pale gray eyes were not smiling; she did not take the prospective
loss of an hour's amusement lightly.
Bruneau went white, and without wasting a word he bounded toward the lift with
improbably long and accurate strides.
Meanwhile Phil Holder sat all alone, sipping thoughtfully on what would have
been his second Scotch after dinner--if he hadn't skipped dinner. A perfectly
sane man would not
have taken the risk of intoxicating himself even a little in the last hours
before an act so audacious as the one Holder now contemplated; Holder, though,
was neither completely sane nor completely foolish. He knew his capacity for
alcohol with intimate precision. He wanted people to believe he was drunk as
usual; moreover, the drinks would take the rasping edge off his nerves, as much
a danger to his plans as alcohol's dullness. And even granted that all the
excuses he could think of amounted to no better than a pile of shifting
rationale, still his drinking would serve as an excellent test of his sincerity:
did he dare remain sober?
He checked his wrist unit: 21:10. Where the hell's Bruneau? Doesn't he care?
Holder took another sip of the foul-tasting Scotch--reputedly an excellent
unblended variety from Lothian, which he drank only for the sake of its
unmistakable odor. He hated Scotch. He grimaced and put down the bulb. Glass
clicked against glass. Glass everywhere.
He rubbed his hand over his face, feeling rubbery skin, trying to avoid his
yellowing eyes in the bar's ubiquitous mirrors. He'd just as soon never see this
particular version of his face again, anyway: a fortyish face, handsome in a
soft-edged, dissolute sort of way, tanned almost black and engagingly wrinkled
by the suns of a dozen worlds--yet somehow looking preserved.
The mirrored walls of the lounge, intended to make a modest space seem larger,
closed in on him instead, mocking him with his own image repeated endlessly
around him, a dozen decadent versions of himself converging at infinity,
reflected in the walls of this alcohol-filled killing bottle.
He was saved by the sudden appearance--a dozen desperate appearances at once--of
Evan Bruneau. H... slap my wrist if Tm pushing, but this was the night you..."
Holder watched Bruneau try to get control of his face, which reflected relief
and contempt before settling into determined obsequiousness. Holder almost
laughed, but he was truly grateful for Bruneau's timely arrival.
"Oh Jeezus Ev, I've let you down again, have I? Probly too late now, huh? Lemme
buy you drink, anyway...."
'That's awfully good of you, Phil, but you could do me a much, much greater
favor." Bruneau grinned sweatily. "The ;|act is, it's just a tad past 21:00...."
',;. Holder peered owlishly at his watch. "Say, you're right as rain, Ev.
There's still time!" Holder pushed himself vigorously away from the bar,
stumbling against Bruneau. ** 'Scuse. Guess me arse is numb."
Bruneau steadied the shorter man with one hand and pressed his thumb against the
countertop charge plate--for all his fumbling, Holder had never been in danger of
paying his own bill. Bruneau steered Holder firmly toward the door.
The lift flashed upward, past a dozen opulent decks visible through the clear
extruded crystal of the pneumatic tube. Holder leaned cozily on Bruneau's
shoulder and closed his eyes. "Ev, 'd I ever tell you about the time at
Epseridan U. when I was so sozzled and I was supposed to give this speech so
I..."
"Sent your friend on instead, pretending to be you?"
"I did tell you!" Holder exclaimed with delight. "And he was so damn convincing!
Ran through all the charts and graphs, knew 'em better than me. Had to call a
stop to it, though," said Holder sternly. "He made too much sense to be a real
ep'demiologist... mislead the public ..."
"Dont get any ideas, Phil. It wouldn't work." Bruneau sighed.
"Oh hell, / know that*' Holder was indignant. "These people already know you."
"But if you really don't feel up to it.. .**
"Relax, kid. IT! be fine," said Holder, miffed. He stood up straight as the lift
doors whispered open.
The projected stars of the desert night twinkled more brightly as the sky light
dimmed in the Sun Grove. Holder stood remarkably steady on the edge of the low
dais, holding the room controls in his left hand. He'd warmed up his audience
with professional aplomb, starting with a few jokes about drunken professors.
Imperceptibly, not letting on that he was turning serious, he began including
scraps of real ideas in his banter.
In the shadows at the back of the room Evan Bruneau allowed his gold-braided
shoulders to relax--it looked as if Phil were going to pull it off after all.
'*... the truth now--it's the lure of the primitive that brings you all to
Darwin, isn't it? Even I still feel it, and I was born and raised here. Even
though I know better than you that ifs a tailor-made brand of primitivism."
Holder laughed.
He fiddled with the room controls as he talked. Slowly an unage began to fade in
all around him, filling one whole end of the darkened room: tree ferns and fat
cycads growing out of dark rich humus, and farther away, the mist-shrouded
shapes of giant redwoods. The plants were merely life-sized, but nevertheless so
big they seemed out of scale. Nothing moved in the dim ruddy light, not even the
tendrils of mist; Holder had not yet activated the scene.
He kept talking all the while. "Once upon a time, hi the good old days--you know
what I mean; I call it the Garden of Eden syndrome--one way or another we all
keep trying to go back. Now, a few years ago I spent some time with the yogis on
Ichtiaque. I learned some things from them, I learned some things about them, I
was lucky enough to solve a problem that had eluded other investigators...." A
few members of the audience murmured politely to indicate they were aware of the
research that had won Holder the Freund Prize. "... whereupon a collection of
armchair experimentalists decided to give me a prize for it," Holder said
blandly, cutting the sycophants dead.
Bruneau was surprised at the acid sharpness of Holder's tone; Holder was a man
who usually lapped up praise. But Bruneau thought that, all in all, Holder was
doing remarkably well.
Bruneau looked at the holofilm with interest. The scene was new to him; Holder's
talks usually began with panoramic views of Upper Cretacia from Mount Owen, one
of Darwin's more inspiring vistas. Holder had brought the forest scene to full
illumination, and had tapped the button that allowed partial animation. Fog
drifted through the trees; water dripped in fat splashes from the spiny fronds
of the cycads; insects flitted through the shadows. The motion cycled on an
imperceptible dissolve, every few seconds--whatever happened later in the scene,
Holder was saving it
It wasn't a professional sensie with smelly-feely tracks, yet it filled the
visual field, and even standing at the back of the room Bruneau felt he was
inside the tableau.
"The yogis, attempting to get back to a presumed state of harmony with Nature
that never could possibly have existed, are the strictest imaginable
vegetarians," Holder was saying. *No animal products of any kind: no milk, no
eggs, they Won't even kill ticks. Yet they were afflicted by a very specific
disease that, so far as we knew, could only be transmitted by eating the meat of
infected loquemels, funny little goat-like creatures indigenous to the planet.
As it turned out, the thing that was making the yogis sick was probably also
keeping them alive."
Holder fingered the controls and the scene stopped cycling. He looked
incongruously at home, standing amid the fronds of the prehistoric forest in his
dark conservative suit and cape, but of course the primeval jungle was illusory.
His head was cocked back and his eyes were fixed on a spot a few dozen meters
back among the dark tree trunks. Unconsciously, every eye in the audience
followed his gaze.
"Seems the disease was carried by a parasite that infested wild loquemel. In the
larval stage, this tiny bug lives in besan pods. Besan provides the yogis with a
staple part of their diet, and they were unknowingly eating an awful lot of the
little grubs with their carelessly cleaned besan--thereby catching the disease.
But those same grubs were providing them with their only complete proteins!
Without that animal protein they would have been just as bad off, or worse."
Holder chuckled. "We couldn't tell them that, of course. We persuaded them to
switch to a different source of besan that just happened to be crawling with
healthy bugs."
At this moment there arose repeated loud crashes in the brush, coming from the
place in the trees Holder was watching. Over the sounds of vegetation being
shredded and crushed came a different, more ominous sound, a guttural, slavering
gurgle, mingled with violent expulsions of breath.
Holder seemed oblivious to his audience's mounting tension. After all, they were
all sophisticates; they'd all seen a thousand skillfully produced sensies,
replete with the most ingenious special effects.
Almost casually he attempted to undercut the excitement. "By the way, I was
thirteen when I took this piece of film, on an expedition organized by my
father. Good old Dad. For those of you who go in for this sort of thing, it was
shot with a Leitz, with the reference beam reflectors set back there on the
trunks of those sequoias, about four meters up."
Bruneau was among those lulled into looking for the equipment Holder mentioned.
As his eyes searched the background, the branches of the redwoods whipped aside
and Bruneau found himself staring down the throat of a roaring Tyran-nosaurus
rex.
Even though he was a dozen meters from the toothy ap-
parition, Bruneau jumped. A collective gasp went up from the audience.
Holder giggled. "Oh come on, this is just a kid's home movie. In a couple of
weeks you'll be on Darwin, where you can see the real thing."
The animal stepped forward. "There! Did you see it?" Holder shouted.
He flicked the controls and froze the tyrannosaur in place, cycling on a
snorting breath. The bulk of the great beast's sixteen-meter length was back in
the brush. Its huge head was carried relatively low and thrust forward, with
rows of sharp teeth curved like Arabian daggers. Its nearly 9,000-kilogram
weight was balanced on colossal three-clawed drumsticks in a running stance:
head, body, and ridiculous stick-like forelegs ahead, massive tail out of sight
behind,
Holder answered his own question. "No, none of you were paying attention." He
reversed the film, and the forest swallowed the creature's head. "Down there, to
the right! Look!" be shouted, as he instantly switched the film to forward.
Smooth naked skin glimmered in the shadows of the underbrush.
Holder froze the image: it was a very young man only partly visible through the
foliage. He wore a necklace of long curved teeth, a coil of rope over one
shoulder, and apparently nothing else. His color was a rich, translucent bronze,
his long golden hair flew out in braids behind his shoulders, and he sported a
full blond beard and mustaches.
"The very picture of the perfect barbarian, eh?" Holder said cheerfully. "He
could be a Viking, a Celt, even a Cro-magnon--right down to the skin color. How
many centuries have gone by since people were that pale?" Holder walked through
the immaterial forest undergrowth until he was standing beside the frozen
figure. "How did this outlandish creature come to be here, playing anachronistic
cave man?"
Holder stood still a moment, then walked back toward the front of the dais,
leaving the ghostly shape behind him. His voice was suddenly mournful. "In a
way, I've spent my life trying to find the answer to that question. I've even
written treatises on the so-called feral tribes of Darwin. But I still cEont
know." In the darkness Holder's expression was unread-t$fe. "Unhappily, I was
never able to discuss it with our t|Bmitive' friend, here."
Bruneau's ears pricked up. Holder's voice sounded dejected, but peculiarly
insincere. What mischief was he about?
Holder started the film. The running man disappeared instantly into the
undergrowth. The tyrannosaur bellowed and exploded from the trees, taking three
frighteningly rapid strides forward. Muffled curses and squeals of fright came
from the audience in the HumboWs lounge.
The odd daintiness of the animal's bird-like gait was more than offset by the
visible, audible effects each time a clawed foot hit the ground: the entire
scene shook dizzily with each thudding step, betraying the unseen laser
recorder's vibrations on its tripod. The nightmare animal stopped in the middle
of the mossy clearing, the red expressionless eyes atop its skull staring
fixedly from under bony orbital ridges. Its mouth hung open, and its breath came
in liquid grunts.
Bruneau shivered. He was awfully glad now that Holder's film was mere sound and
picture. Even in his imagination, the stench of the carnivorous dinosaur's hot,
wet breath was almost overpowering. Then a horrible thought occurred to Bruneau--
just as the great reptile's head twisted and darted forward into the brush.
There was a horrible scream, indisputably human.
"Oh, really, Phil, you mustn't!" Bruneau protested loudly, taking a step
forward.
"For those of you who are still with me," said Holder, "have a look at this...."
Then Bruneau realized he'd been completely fooled; Holder had not been sober for
an instant! The whole episode was a boozy practical joke. Nauseated groans and
shouts failed to deter the intoxicated doctor, who continued to expound. Bruneau
lunged toward the stage to interfere, but found his way blocked by members of
the audience who were in a hurry to leave.
Inside Holder's "home movie" too, there were running figures. Bruneau had time
to make out a boy in his early teens--Holder himself?--running toward the
thrashing in the bushes, and a middle-aged man who suddenly caught up to the boy
and cuffed him out of the way.
Bruneau was almost to the dais now. The fern leaves towered over his head. And
then the tyrannosaur stood erect. It, too, towered over Bruneau, so high and
awesome that Bruneau almost stumbled in fright. The red gobbets that dripped
from its jaws resembled nothing like a man.
"... incidentally demonstrates the answer to a question that puzzled
paleontologists for ever-so-long, before the re-creation of rex," Holder was
remarking, nonchalantly. "Scientists could conceive of no possible adaptive
purpose for the creature's tiny forelegs...."
"Phil, for God's sake!" Bruneau shouted.
"But they are quite useful, as it turns out," said Holder.
The carnosaur ducked its head and lifted a pan- of short, curving little
foreclaws to its mouth. Then it began ....
"Picking its teeth," Bruneau murmured. "Oh, God." He jumped onto the dais and
walked toward Holder. "Phil, please...."
Holder looked at him. "My g'ness, Ev." A bewildered expression came over his
face; he bunked. "Have I gone too far?"
"Yes, Phil. Much too far indeed," said Bruneau, trying to hold his temper.
Holder peered at Bruneau, apparently puzzled by the anger in his friend's voice.
Confidence drained out of him.
"Come on, Phil," Bruneau sighed, feeling the barest twinge of remorse. "I'll get
you safely to bed."
"Oh. Sure. Sure, Ev, I'll come with you." Holder absently tossed the room
controls into the make-believe bushes.
"Oh, Phil!" For a moment the exasperated Bruneau considered searching for the
controls, but decided it was more important to get Phil Holder safely put away.
He took him by the arm; Holder stumbled against him.
Bruneau escorted the confused doctor out of the room, guiding him gently past a
number of angry guests who jostled him and hissed their spite. But as Bruneau
made his way slowly up the aisle he noted that a good many passengers seemed not
the least upset by the graphic sensie display. Bruneau saw Loa Westcliffe and
Robby Fain and Vivee ChilHngsworth among the audience who continued to watch in
slack-jawed masturbatory rapture as, behind Bruneau and his bewildered charge,
in the depths of the starship's elegant lounge, the apparition of Tyrannosaurus
continued to munch, and pick delicately at the stringy remains of its dinner.
'�Clarissa Sirich was in at the beginning; indeed, as became apparent only much
later, her presence defined the beginning as such, though she was not herself
the initiator of those historic events hi Cole's laboratory/Born on April 25th,
1979 O.E., her name was originally Margaret Tanner, and she was the daughter of
the renowned research biochemist..." (from Darwin; A Millennium of Conservation)
Stefan Lazarev was twenty-two years old, an experienced operator of heavy
equipment, but more used to the suburbs of Moscow than the permafrost regions of
the sub-Arctic. He had lately been recruited by the Komsomol and assigned along
with a half dozen other bulldozeristy to a railroad construction camp north of
Tommot, where he was helping to build a major new spur connecting the Baikal-
Amur Mainline at Nagornyy to the city of Yakutsk on the Lena.
On this particular afternoon Stefan was working alone, following a line of
stakes set out the day before by a surveying crew, cutting an access road
through the birch trees and stunted firs with the blade of his big American Cat.
Spring comes late to the taiga, but brings with it a profusion of sweet
wildflowers and lush green grass and long warm afternoons that stretch into
soft, perfumed twilights. In such a climate love blooms as quickly as the
flowers. The tousle-haired youth was thinking about a girl named Valentina from
the track gang, not about safety, as he brought the noisy uiesel to a halt near
the banks of a little brook.
Stefan climbed down from the Cat and stood stfll a moment, feeling the sun on
his face, hearing the whisper of wind in the leaves. Then he carried his lunch
tin to the dappled shade of a ring of birches. His only concession to caution
was to bring along a beat-up old hunting rifle against the sudden, if unlikely,
appearance of a bear.
He was little prepared, then, when having chewed his way through half a chunk of
black bread he heard a sudden agonizing groan behind him. He leaped to his feet,
spewed 'out his mouthful, and snatched up the rifle. Spinning around, he was
just in time to watch with horror as his Cat's enormous steel blade slid beneath
the surface of the earth, followed by a rattling splash of gravel. The little
meadow brook was pouring into a crater where lately his wonderful new machine
had been parked.
To lose a bulldozer! He refused to believe such a tragedy had befallen him. He
raced to the edge of the hole and peered down in anguish.
Stefan had been warned about ice caves, and at the time he had thought he was
paying attention to the lectures. But perhaps only bitter experience can
convince one that the ground over much of Siberia is no ground at all, but only
a thin layer of top soil over ice many meters deep, many millennia old. With
each annual thaw the ground cover becomes rotten and treacherous.
Stefan sat on the soggy ground beside the hole and fought back tears. After a
long while he came to his senses, realizing that the Cat could be salvaged
easily enough by the work camp's big crane, and that the immediate need was to
retrieve his loose tools and personal gear. The bulldozer was tilted up at a
sharp angle, its blade facing him about a meter and a half below. He stood and
leaped down onto the wide curved blade. It was spooky, clambering around in the
cold dripping half-light, swearing, and hoping that the massive machinery would
not sink further into the ice in the next moment. Eventually Stefan had gathered
all the gear he could get his hands on and began to climb back out of the chill
pit
While he was studying the frozen face of the sinkhole, looking for a sturdy
handhold to help him to the top, Stefan saw the vague dark shape of the ice-
locked mammoth.
Sheer accident brought Hank Cole and Yurii Amosov together for the 1999 annual
meeting of the International Society of Cryobiology in Sri Lanka. Cole was in
the Colombo Hyatt's veranda bar waiting for his wife and son to return from a
shopping trip, and Amosov wandered in to wait for the restaurant to open. Both
events being delayed, the two men got to talking.
Cole wasn't even attending the meetings--he and his family were vacationing and
he'd dropped in to say hello to a colleague from the States. As a molecular
geneticist, Cole had a passing acquaintance with some of the techniques of cryo-
biology, but it wasn't really his line.
It wasn't Amosov's line either, but he was at the meetings on purpose. A
vertebrate paleontologist, a successor of the energetic Vereshchagin at the
Zoological Institute in Leningrad, he was seeking to learn more about the
effects of different conditions of freezing and thawing on mammalian cells,
hoping to apply this knowledge to the study of Pleistocene animal tissues
recovered in various states of preservation from the frozen tundra.
Amosov and Cole hit it off immediately, and after a couple of drinks the two
men--both possessed of impish senses of humor--had concocted the most outrageous
scheme....
A few months after-Stefan Lazarev's bulldozer fell into an ice cave Hank Cole's
lab at Stanford received a shipment by air from Leningrad. Cole's graduate
student Margaret Tanner helped open the well-insulated case of steel-jacketed
bottles bearing the multilingual label, "Warning: Liquid Nitrogen. Do Not Open
Manually," with a long list of detailed instructions. Inside the bottles were
tissue samples taken from many parts of the body of "Natasha," history's first
completely preserved adult woolly mammoth. None of these samples were in the
best imaginable condition. Most, frozen too slowly, had been damaged by salt
concentration as the cells dehydrated and shriveled, and a few, frozen too fast,
had suffered disruption from needle-like ice crystals. A tiny fraction of the
cells, however, exhibited nuclei in excellent states of preservation.
DNA is an extraordinarily stable molecule (if it were not, inheritance would be
a very chancy business indeed), and from the nuclei of Natasha's cells Cole
proposed to obtain enough intact DNA to model a typical set of somatic cell
chromosomes. The ultimate aim of the study was to compare the mammoth and the
modern elephant by locating those genes that specified slightly different
sequences of amino acids in proteins otherwise common to both creatures.
It was important to know that any differences were indeed due to evolution and
not to several centuries in the deep freeze. Applying sophisticated statistical
analysis to many different partial models--some visual, derived from electron
micrographs or soft X-ray replicas, others mathematical and chemical, based on
advanced electrophoretic, chromotograph-ic, and enzymatic techniques--an
idealized mammoth genetic sequence was at last obtained.
Cole and Amosov wrote up a spate of papers, signed them jointly, and sent them
off to the journals. But they did not sit back and wait for notoriety to strike.
Selecting several slices from Natasha's intestine, Cole carefully brought the
frozen tissue to the normal internal temperature of an elephant's body, using a
buffering solution Amosov bad derived, which included "antifreeze" glycoproteins
from the blood of Arctic fish. Cole's choice of intestinal cells was not random.
Evolutionary theory suggested that the association of digestive and reproductive
functions was not God's dirty joke--cells near the gut were the best nourished,
and had the best chance to survive.
Cole microsurgically removed apparently perfect nuclei from choice thawed cells
and slid them gently into fresh de-nucleated cells from living African
elephants. If the mammoth's genes could function without error inside the
elephant's cells, it would be good evidence that the Cole-Amosov model was
correct. Several months passed. Cultures descended from some of the transplants
continued to thrive.
Then Cole proceeded to thaw another set of mammoth cells. This time the
recipients of the mammoth's DNA were an elephant's egg cells. An application of
hormones started the hybrid gametes dividing and multiplying in vitro.
While Cole, dressed in an immaculate white coat, performed these delicate
sterile operations in the gleaming stainless-steel environment of his laboratory
in the handsome biochemistry building, Margaret Tanner and two other grad
students wrestled with the realities of biomedical research on an earthier
level. Several hundred yards from the School of Medicine a rude wooden compound
had been set up under the shade of huge eucalyptus trees on the dusty plains of
Leland Stanford's famous horse farm. The farming that went on inside the
compound had nothing to do with horses.
A half dozen female specimens of Loxodonta africana had been borrowed from the
San Francisco Zoo along with an amused keeper. Every day an adult African
elephant typically consumes thirty-five kilograms of hay, alfalfa, oats, or
vege-
20
RE-ENTRY
tables. Cole's students spent their days with pitchforks and shovels in their
hands, not microscopes.
After consultation with expert breeders Cole had decided to impregnate the
elephants with frozen sperm from the nearest captive bull, who lived in
Portland's Washington Park (most zoos would as soon do without a male's nasty
temper). The complex changes in the uterus brought about by the onset of
pregnancy can be mimicked by applying estradiol and progesterone, but Cole
wanted to take as few chances as possible. The impregnation itself was done
manually by Cole's unfortunate pupils.
The eggs fertilized by the testy Portland bull did not long survive. In a series
of messy, intricate operations, Cole aborted the six cows and at the same time
replaced their nascent embryos with glass-grown blastocysts from his laboratory.
Now there was nothing to do but wait. One after another, all but one of the
pregnant elephants aborted again, this time spontaneously. Examination showed
fatal developmental flaws of the fetuses. Cole and bis long-suffering students
all but gave up hope.
Two years passed, and all that time a 40-year-old cow name Mabel held on. She
was a taciturn beast, and nothing seemed to upset her. Already she'd been the
mother of two natural young. Nevertheless, Cole had long since resigned himself
to the inevitable.
Miraculously the impossible arrived before the "inevitable.** Hasty phone calls
between Palo Alto and Leningrad brought Yurii Amosov on a special Aeroflot jet
just in time to be on hand the day Mabel, the African elephant, gave birth to a
perfectly healthy young woolly mammoth.
They named her Stefania, after Stefan Lazarev, the workman who had been her
unwitting godfather and who, all unknowing, had brought her back from the dead.
Her foster mother would nurse her for six years, like any ordinary elephant
calf. In twelve years she would be mature, standing almost four meters high at
the shoulder, covered with a fine wool undercoat with long black wiry hair
growing through it, and sporting spectacular in-curving tusks three meters long.
Stefania would always be an affectionate beast, willing to scratch her keeper's
scalp with her curiously double-"fingered" trunk in return for a handful of
carrots.
But on her birthday no one yet knew what to expect They
RE-ENTRY
21
could only hope that a living creature had been brought back from ten thousand
years' extinction, once more to walk the earth in majesty.
And from the sidelines Margaret Tanner watched, and pondered, and laid vague
plans for the future.
Pinpoints of reflected light glistened wetly on the surface of Holder's half-
open eye. He stared straight down. He had not stirred for hours.
A few centimeters beneath his nose, myriad filaments of glittering optical fiber
snaked around shadowy struts and beams. He looked through the floor of his first
class room-with-a-view, past its structural bones, its arteries of plumbing, its
light-fiber nerves, down through the ship's outer crystalline skin. The whole
sparkling skyscraper dropped away beneath the feet of Holder's bunk, where he
lay face down, his head and one arm dangling over the side.
The cliff-like face of the ship was a multi-faceted array of glowing crystals--
emerald, ruby, amethyst, yellow diamond-- revealing themselves on close
inspection as instrument ports, observation galleries, promenades, and
individual suites whose walls had not yet been opaqued for privacy this night.
Far below, a pearly corona of light escaped beyond the edges of the energy
shield surrounding the veiled stern engines, the only visible sign of the
annihilators' unbearably bright flame.
Despite the immense structure's velocity of some 60,000 kilometers per second,
twenty percent of light speed, nothing betrayed Humboldfs motion through space.
Nothing moved at all, except here and there a shadow cast on a yellow pane of
quartz.
Before Holder stirred, all those shadows would stop moving.
After the fiasco in the Sun Grove, Evan Bruneau had steered Holder to his suite,
just managing to get his evening
22
RE-ENTRY
cloak off him before Holder batted him away, groaning. Bruoeau had straightened
him out on the bunk, pulled off his boots, spread a thin blanket over him, and
then retreated, blanking the lights as he went Holder was already snoring
loudly.
A-few minutes later Holder had started thrashing about-- ending up half off the
bunk with the blanket bunched under him, presumably more comfortable. In the
course of these seemingly unconscious struggles he'd hit the bedside opaquing
controls, turning the walls and floor to "clear." He hadn't moved since.
Amid the jeweled wonders below him, one dark area held his attention: a cluster
of large, wedge-shaped objects blackly silhouetted against the luminous hull
like bats clinging to the roof of a crystal cave. These were Humboldfs planetary
land-ers, winged launches she routinely used to communicate with more remote
ports of call, planets that could not conveniently provide their own high-
orbital shuttles.
Darwin was by no means remote, being a prime attraction for wealthy tourists.
The planet had a well-appointed orbiting entry station with comfortable service
to the surface. Therefore, with superspace insertion due in less than fifteen
minutes and Darwin still some weeks away, Holder doubted anyone but himself was
giving the landers any thought.
The soft, soothing precisely polite voice of Humboldfs computer sounded from the
room's speakers, at a level of volume just sufficient to be clearly audible to
any passengers who might still be awake. "Ladies and gentlemen, in exactly ten
minutes the Humboldt will cease acceleration in order to prepare for superspace
insertion. This will result in a temporary condition of weightlessness. After
our ship emerges from superspace we will perform a simple maneuver in order to
align our main engines for deceleration. Immediately thereafter weight will be
restored. The total period of weightlessness will be approximately five minutes.
During this period, for your comfort and safety, restraining netting will
enclose your beds. To insure that everyone is safely restrained, your rooms will
be placed under automatic surveillance in exactly three minutes from now... .**
Holder did not move. He knew, as most seasoned travelers did, that the
surveillance cameras were never really turned off. Holder listened as the
computer explained that anyone
RE-ENTRY
23
who did not wish to stay in bed during the weightless period would be "assisted"
by a crew member.
"... therefore we now suggest that all passengers not in bed return to their
beds, lie down, and make themselves comfortable. Thank you! Ladies and
gentlemen, in exactly nine minutes the Humboldt will cease acceleration in order
to prepare for superspace insertion. This will result in a temporary condition
of weightlessness ..."
Superspace insertion required extraordinary precision, but there were no tricks
to it Provided a ship entered the space-time hyperfold at Earth Station at just
the right point, she would emerge from superspace at Darwin Station. It was that
ample. If the ship entered the fold at some other point, she would emerge near,
say, Tau Ceti, or Brindle, or any of a few dozen other selected planetary
systems--or for that matter, at any point within a spherical radius of a couple
of hundred light-years that happened to be blessed with a double Mack hole
system. A ship's point of exit depended wholly and simply on its point of entry.
Humboldt had been riding a ref-erence beam from Earth Station's robot
navigational monitor since acquiring the beam two weeks out from Earth,
Penalties for straying from the beam were severe. A misguided exit from
superspace through a single black hole was inescapably final: the ship and its
contents would emerge as a shower of radiation, never escaping the far event
horizon, serving only to enlarge the mass of the hole. Not only were double-hole
Stations essential to avoid singularities, by providing a fold in spacetime
rather than a tunnel through it, but also to provide null-gravity paths that
could keep a ship from being ripped apart by tides.
Thus a ship could leap a hundred light-years with ease to reach Ichtiaque or New
Albion, while other star systems only a few light-years from Earth remained
effectively off limits forever, accessible only through vast stretches of
ordinary sp&cetime.
The properties of hyperfold Stations had been thoroughly understood for
centuries, in an empirical way, and interstellar travel was commonplace--even
safer than air travel near a planet's surface. Besides the well-known properties
of double black holes, however, there were certain other properties, little
spoken of, speculative in the extreme, known only to a few-- and never tested.
Until tonight
24
RE-ENTRY
"... will now enclose your beds. Please lie still. Do not be alarmed. The
restraining nets will leave an ample space for ordinary movement. They will be
withdrawn shortly, immediately after weight is restored. Should you require
assistance, do not hesitate to use the call button at the head of your bed...."
The tough, fine restraining net unfurled slowly from under the left side of
Holder's bunk. Carried smoothly up and over him on half-elliptical tracks
mounted on the head and foot boards, the leading edge of the net would fasten to
the right side of the bed by means of evenly spaced electromagnets.
Holder moved his dangling right hand slightly at the last possible moment. A
magnet in the descending net came to rest on his hand, failing to make contact.
He now had a space between contact points, less than a meter long. The netting
material should give just enough to allow him to slip through.
Patiently he waited, as he had for hours, drawing on the mental disciplines he'd
learned during a year spent on Ichtiaque. With ironic detachment he reflected
that had he learned all the yogis desired to teach him he would not be embarking
on this bizarre journey. But he was "nailed to the Wheel of Life," as the yogis
would have had it--he made use of their teachings only to control his body, not
his awful moral hunger.
"... do not be alarmed. Weightlessness will begin now. Do not be alarmed...."
Finally he felt it: acceleration stopped. The faint quantum glow at Humboldfs
stern vanished. Holder pushed gently against the floor with his fingertips. His
whole body floated off the bed.
He waited yet another half minute. He knew the safety officers used that time to
make a quick video inspection of the passenger quarters, to satisfy themselves
that all civilians were safely under lock and key.
Now. Holder rolled upside down m the space between the top of the bunk and the
free-floating net. He grasped the edge of the net firmly, and pulled himself
into the gap. For a second he wriggled and kicked, and then he was clear.
Three minutes to zero.
He reached under the bed and snatched the canvas satchel-he had placed there. In
the luminous dark glittering with pinpoints of fire, he swam like a dark diver
among schools of flashlight fish. A strong kick of his stockinged feet against
the
RE-ENTRY
25
wall sent him darting to the door. He yanked it open, knowing as he did so that
an alarm sounded simultaneously on the control decks above.
Outside in the corridor a red panel bunked frantically over his head, but he
paid no attention to it. Kicking with all his strength against the door jamb, he
flew flat and fast down the dimly lit corridor toward the center of the ship.
Two minutes and forty seconds to zero.
He felt heady. Hours of enforced immobility followed by sudden strenuous
activity were exacting their inevitable toll. But he had known what to expect.
He reached the ship's central galleries. Without pausing in his flight, he
hooked his free hand over the molded acrylic banister of one of the ship's three
grand staircases. He neatly executed a ninety-degree turn straight "down,"
boosting his flight with a double kick against the rail. He held his eyes open
long enough to judge his trajectory. Then he closed them against the onrushing
vertigo that tried to persuade him he was falling to his death.

The annihilates and the superhydrogen tanks that fed it took up the whole of
Humboldt's core; the ship's human activities were concentrated in a thin husk
wrapped around this stem. The helical staircases, along with the transparent
elevator tubes, descended the full height of the ship, winding around
unobstructed shafts of open air down which passengers could peer to savor the
space liner's majestic length,
When he opened his eyes he had hurtled past twenty decks. He had two minutes and
twenty-five seconds to zero.
Still no interference from the crew! He knew they were coming; they knew where
he was. But so far he was ahead of them. A fierce flush of excitement welled up
in him. His plan was working without a hitch I
He swung his satchel overhead, veering a few degrees in his headlong flight,
rolling over in midair. The roll caused him to misjudge his aim--he collided
painfully with the banister, taking the blow on his upper arm. He gasped.
Grimacing, he fumbled for the next floor's railing. He managed to hold on for an
instant, just long enough to flip him end for end. At the next story he hit the
rail with his shins. Then he managed to hook both his hands over it, sliding a
couple of meters, burning his palms, with his satchel bumping the uprights.
Finally he came to a stop on the stairs.
He checked his wrist unit Two minutes.
26
RE-ENTRY
Almost dispassionately, Holder noted that his breath came in sobs, that he had
cracked his shins and wrenched his shoulders and blistered his hands. He was not
a young man. He'd had no illusions about that, though. All in all, things were
going remarkably well.
He sailed up the stairs to regain the floors he'd missed. Now he could see them
coming, two elevators descending in their transparent tubes, away around the
curve of the ship on either side of him, coming at him fast but still ten floors
away.
A glance at the corridor marker assured him he was where he needed to be: D
Deck, four floors above propulsion maintenance; Corridor 27, 270 degrees from
dorsal zero. Lander D-27 was reached through this corridor. Again he launched
himself into the air.
The corridor doglegged at the end, debouching in the small loading room
alongside D-27's main hatch. For safety, there were airlocks leading into the
corridor and, opposite, into the lander. They were always closed. They would
cost him a precious few seconds.
Holder bounced around the end of the corridor and came up against the clear
quartz wall that held the lock into the padded loading room. His heart leaped
into his mouth.
There were guards in the room!
Holder's head spun. How had they gotten here ahead of him? There was a third
entrance to the room, a small non-airlocked hatch from a maintenance tube that
paralleled the corridor--and sure enough, that hatch stood open. So much for
physical access. But how had they known?
It must have been Bruneau. Evan must have put two and two together and directed
the security detail to this loading room, this particular lander. Holder had
talked way too much back in the beginning, a couple of trips and a couple of
years ago; he'd asked Evan too many detailed questions about the capabilities of
the captain's launch, D-27, and about the procedures followed during superspace
insertion. Back then all this had been a flight of fancy, a joke, really--not the
life and death commitment it had since become.
Precious seconds passed while Holder thought. The guards inside the room floated
impassively, making no move toward him. Their dark face-plates hid their
expressions; they might as well have been a pair of robots. They knew Holder was
trapped between them and the larger force who even now must have reached the end
of the corridor.
RE-ENTRY
27
Holder stabbed his finger at the guards, and then toward the maintenance hatch
through which they'd come. Then he pointed toward himself, and toward the outer
airlock. At first they did not move, but when Holder reached for the emergency
trigger, accessible from both sides of the wall, they reacted in startled
horror.
He deliberately opened the safety cover. From the corner of his eye he could see
the panicked guards diving for the maintenance hatch as he tripped the delay.
A moment later a thousand kilograms of steel disintegrated under the impact of
the explosive charge, half bursting into the corridor on a flat trajectory, the
other half into the room. In the absence of gravity the debris scattered
elastically.
That explained the dogleg hi the corridor, of course. Holder had barely gotten
around the corner and gotten his mouth open and his fingers hi his ears before
the lock blew up.
The smoke and crash of the explosion brought the pursuing security squad,
halfway down the corridor, to a momentary halt.
Holder darted quickly into the loading room, flew across it, grabbed and spun
the wheel of the second lock with his feet braced against the wall--he had no
time to wait for the motors. Chunks of shattered steel still bounded around
through the thick gray smoke, along with ripped-out shreds of padding. A jagged
piece of metal tore the cloth on Holder's thigh.
He noted with relief that the maintenance hatch was closed.
He swung back the inner door of this, the primary lock. It was smaller but far
more massive than the first lock had been, a vital orifice penetrating Humboldfs
skin. No explosive charges here--they could only do more harm than good.
Holder guessed he had about thirty seconds remaining-- less than he'd hoped, but
still barely enough. He'd planned to close this hatch behind him, but he
abandoned that idea; it would take too long. The ship's emergency systems would
handle the decompression by filling the airlock with polyfoam.
He unlatched the outer door, which was in fact the hatch .of the lander. The
lander door sucked open, hydraulically cushioned against the crushing weight of
air inside Hum-bddt; Holder braced himself in the wind. The lander was fastened
to Humboldt by the skin of its belly. Holder reached up to pull himself into the
craft's fuselage, grasping the edge of the floor.
28
RE-ENTRY
He heard a clang behind him. Probably the security guard.
"Phil! For God's sake, man, what are you doing? You'll kill yourself!"
Evan Bruneau was climbing out of the maintenance hatch. The guards were nowhere
in sight. Bruneau's face was twisted in pain.
"Get out of here!" Holder screamed at him. "I don't have time to fool with you!
I'm blowing a hole in this ship!"
As Holder turned to plunge into the lander he realized Bruneau was still coming.
Then he saw the blood trickling from Bruneau's ears.
The man was deaf. The shock wave from the exploding hatch must have caught him
inside the maintenance tube. The guards, too.
"Oh, sweet Jesus." Holder turned back away from die lander. He grabbed the heavy
door, hooking one hand around the grip provided for this purpose, and slowly
began pulling it to.
Bruneau was floating toward him, his mouth agape, his fingers outstretched. But
Holder was faster, sealing the heavy hatch between them, cutting Bruneau off
from his sight. He took the precious seconds needed to dog it shut.
Bruneau wanted to save his life. Holder could not sacrifice him in cold blood.
True, he was late now. That might cost him his life after all. So be it.
Ten seconds left.
He pulled himself into the lander and sealed its hatch. He pulled himself
rapidly, hand over hand, past the half-dozen lounge chairs toward the cockpit
door. He yanked it open, and thanked God it wasn't locked. With no time to force
it, it could have condemned him absolutely.
He settled himself into the pilot's couch, yanked the acceleration harness down
over his shoulders, reached into the breast pocket of his tunic, and pulled out
a programmed code sliver. He jammed it into the slot in the lander*s autopilot
and slammed the "start" sequence switches.
Holder hardly had time to take half a breath before D-27 snapped its shackles
and hurled itself in a backward dive away from Humboldt. Through the quartz
plates over his head Holder could see the great length of the starship wheeling
in the sky at what seemed an agonizingly slow pace. D-27*s. rockets fired in
exact sequence, following the program meticu-
RE-ENTRY
29
lously. Now it flew parallel to the parent ship, upside down, with nose pointed
astern.
Out here, away from the glow of the ship's myriad windows, Holder could see the
stars again. They shone cold and needle sharp, unblinking. Therefore, either he
was still in time or they had already passed through the hyperfold and it was
all over....
He dared look at his wrist unit. He could hardly believe his eyes. He had two
whole seconds to spare! He looked up, allowing himself a smile.
As he did so, the universe all around him went dark, as the stars sucked into a
point behind his back, in the same instant blurring and disappearing in red
smears.
The rest was an image constructed from nerve impulses that reached him an
eternity after the event they recorded had ceased to exist: over his head, a
hundred meters up, the Humboldt stayed the same; they were inside the hyperfold,
both Humboldt and the little lander that had budded off her at the last instant,
and already the lender's rockets were exploding with maximum power, and Holder
was dragged deep into his couch, his cheeks sagging under violent acceleration,
and Humboldt was gone.
Before his eyes all was double vision. He didn't know if it was because he was
losing consciousness or only because of the familiar momentary sense of time
reversal inside the fold. Perhaps both. Lose consciousness he did, as his stolen
craft accelerated away from Humboldt with all the power it could * muster.
Philip Holder slid into oblivion. If he had calculated incorrectly, even by a
fraction of a percent, he would never wake up.
Angelica Claymore's private bird climbed swiftly to 15,000 meters and locked
into the westbound security traffic lane.
30
RE-ENTRY
At 2,000 kilometers per hour she would have a couple of hours to brush up before
her plane reached the west coast.
Word of the bizarre incident aboard Humboldt had reached Washington the day
before, after traveling more than a week at the speed of light. Humboldt had
radioed through the relays at Darwin Station and Earth Station immediately upon
emerging into Darwin*s Star space, but Earth Station relay was a long way from
Earth, and moving forty kilometers farther away every second.
Claymore satisfied herself that the rocket plane was functioning as it should,
then swung her couch away from the control panel. The acceleration restraints
retracted as she did so. She rose from the couch, crossing the cabin to the
plane's bar unit and punching a sequence on its keyboard. Most people addressed
bars vocally; Claymore avoided talking out loud to robots.
The espresso would take a few moments. Anything done right takes time. While she
waited she gazed out of one of the plane's forward windows at the banks of cloud
far below, folded like whipping cream against the sinuous ridges of the
Appalachians.
The cloud deck shrouded the squalor of the surface. Looking down, Claymore felt
a shiver of triumph. She had made it to the top, almost to the very top. The
plane that carried her far above the stink and jostle of the tubes was in itself
a symbol of her status and value to her government, to Speaker Macklin himself.
An optimistic symbol: though held aloft on slender wings in a rarefied
atmosphere, the plane was perhaps more secure in its place than she.
Mentally she changed the subject. Humboldt must even now be nearing Darwin under
heavy deceleration. Unlike Earth, Darwin was near its stargate. There were dark
rumors that someday Earth, isloated as it was, would become just too expensive
to carry on the scheduled runs. Even now, only the wealthiest, or those on
official business, could afford to travel. Earth Station's extremely eccentric
orbit meant that inevitably the center of civilization would move to other
worlds-- Epsilon Eridani was making a bold bid--leaving Earth to slide into
cultural decline, a teeming ant heap of poverty in a Galactic backwater.
All the more reason to stay on top of the heap.
The bar unit pinged and Claymore reached for the tiny porcelain cup, easing it
out of its friction cradle under the
RE-ENTRY
31
coffee spigot. She took it to the hand-carved teak table in the back of the
cabin, sat down in her leather-upholstered lounge chair, and slipped off her
shoes. For a luxurious second she allowed her toes to wriggle in the silken pile
of the ancient Turkish prayer rug. She leaned back in her chair, reached into
her case and withdrew a fileslab, and flipped on the book projector. Crisp
printed words flowed brightly through darkened space in front of her eyes. She
took a sip of her coffee.
Holder, Philip A.--Infofile Class 3 (fact), Security Access Only. Date of birth:
164 N.E., 6.103 X 10s sees Gs (25th Deca, local). Place of birth: General
Hospital of Cuvier, Cuvier, Galapagos, Republic of Darwin (Darwin, Darwin's
Star).
Current citizenship: Republic of Darwin.
Duration code showed the file to be a long one. Evidently the agents had made an
extra effort because Holder was an offworlder by citizenship and birth, a
Darwinian at that. His father had held middle and upper management positions
with the Rangers, as the Darwinians called their civil service, and Holder had
been privileged to enjoy a comfortable childhood in a variety of spacious,
interesting surroundings.
Just in these simple facts Claymore found cause to dislike her quarry. That
helped: it made her senses sharper, the quest more urgent. It was also essential
if she were going to self-induce an override to her anti-assassination
conditioning. Her ability to do so was one of .the things that made her so
valuable to Security. But though possible, it was not easy, even for her.
Her own childhood had been somewhat different from Holder's. Her parents had
been artists, struggling to earn a living in the legitimate theater, her mother
as an Assistant Creator, her father as a gladiator. Claymore remembered the long
tube rides from the slums of Westchester to Shea Colosseum to watch the Sunday
afternoon productions. When she'd been very small her father had always been
among the first rank. Often he'd won, but how she'd cried when he'd been killed
or dismembered! On those occasions her mother had kissed away her tears,
assuring her that, after all, it was only a Circus. Later on she could rarely
distinguish him in the pageants; he was usually assigned to play a galley slave
or a
32
RE-ENTRY
RE-ENTRY
33
Christian, or one of a horde of mudmen or Amerinds or Titanian jellywings, all
of whom always died in anonymous heaps in the background.
Shortly after Claymore had earned her manual labor permit at the age of
seventeen her father had applied for brain-burning. She never saw him again.
Brainburning was as good as death as far as relatives were concerned--better,
really, since no decisions had to be made as to the disposal of the remains.
Claymore was sure she was personally responsible. She thought it must have been
the cost of her vocational education that had so exhausted her father before he
reached the age of forty....
... Sex at birth: male; Current sex: (unchanged); Race: sapiens sapiens (see
illustration this locus. Access class 2 infofile this locus for genetic sequence
abstract and profile, and psychological assessment.)
Education (formal): University of Darwin (n.d.), University of Epsilon Eridani,
B.S. '86; U EpsEr, Ph.D. '88. M.D. '90; Internship, Trebler Medical Center
(EpsEr) '90; Residency, TMC '94; Research Fellow, University of Papua New Guinea
(PNG, Earth, Sol) Center for the Advanced Study of Cultural Patterns of Health
'94-'96; Certification: Pan-Eridanian Board of Medical Examiners, '96; Academic
and scholarly awards, honors...
At eighteen Claymore apprenticed herself to the local Courtesans' Guild, knowing
she was lucky to be accepted-- the competition in New York was world class. Her
small salary, minus an essential clothing allowance, went to her mother. Coming
home one morning to the room they shared in alternating shifts, she found a note
taped to the communicator screen. In her mother's hand, it said only, "You must
live your own life."
She received the routine official notification later that day. Her mother had
applied and been accepted for brainburning. �She knew better than to try to
learn anything more through government channels.
Claymore was skilled at her new craft and was quickly promoted; too much
training is inefficient if youth is wasted. She cultivated a theatrical
clientele, hoping to learn some-
tiling of Circus politics. She heard that her mother's recent writings had been
rejected, viewed as skirting on sedition, though no formal complaints had been
lodged. As an Assistant Creator, Claymore's mother rarely had the opportunity to
do more than simply develop the tech sheets needed to flesh out the Ringmaster's
stale notions of spectacle. Sedition? Perhaps she had directed a thousand flower
girls to arrange themselves to spell out, "Speaker Macklin Sucks."
The truth, as Claymore found after she dug a little deeper, was as clich&3 as
the Ringmaster's "creations": the Ring-iqaster had insisted, Claymore's mother
had resisted, to the penultimate degree.
Revenge was out of the question. The best Claymore could do was resolve never to
find herself in the same position. She managed to convince herself that she
despised men (excepting only the memory of her sainted father). Thus she was
able to remain unaffected by male demands. She was smart enough to hide her
indifference.
... Residence: Parnassus, San Francisco, Alta California (USNA, Earth, Sol)
//Update: research mission to Darwin commenced 7 March 206 (Earth local) aboard
Licensed Space Liner Humboldt, in progress// //Update; voyage of Humboldt
interrupted by ...II
Claymore jabbed a finger at the book projector before it stuttered into realtime
and started feeding her satfax,
... Employment: Research Professor of Epidemiology, University of Alta
California Medical Center, San Francisco (access class I infofile this locus for
security assessment) ...
No one stayed at the forefront of the oldest profession for more than a few
seasons. Claymore had to find a way out or become a candidate for brainburning,
or at least drug maintenance, herself. Fate intervened, in the form of a
handsomish, youngish aide to the Director of Security Services. Looking for
kinky action, he found instead an excellent imitation of the girl next door, and
instantly infatuated himself--partly because he saw through her cheerful
accommodating smile to the contempt beneath. That anyone should presume to be
34
RE-ENTRY
contemptuous of his looks, charm, breeding, and position so captivated him that
he determined to win her.
The usual gifts got him nowhere (he wasnt surprised) and neither did his
proposal of marriage (he was only mildly surprised; after all, the pro rata
community property share after a standard three-year trial was not that great
compared to what an expert like her could earn as a freelance).
So he played his tramp, offering her a job in his department. She feigned polite
interest, allowed him to guess at cool indifference, but completely disguised
her deep, desperate need. Finally he persuaded her to accept. Once the contracts
were signed she never spoke to him again outside of business.
Shrewd, adept, and ruthless, Claymore did not allow herself to be wasted as mere
provocative bait in minor subversion capers. She sought and got advanced
training--weapons, unarmed combat, air and space navigation, code, languages-- and
within five years she was an independent agent. Within ten she was practically a
member of Speaker Macklin's family. She was at the top.
After a few minutes Claymore finished Holder's file. She'd memorized most of
what she'd have to know immediately, though she'd go over the file several more
times to absorb what she could of what subtleties might lurk between the
telegraphic phrases. Restlessly she rose to her feet, bent over fluidly from the
hips, and draped the backs of her hands against the soft carpet. She
straightened and went to the window, her bare feet cold where they touched
uncarpeted metal.
Below was a geometrically fractured brown smear, a dazzling expanse of blue, an
even brighter expanse of white. Water-starved Salt Lake City, in ruins. Not much
time before the plane reached San Francisco.
She sat down and pulled out a second fileslab. Its contents had been purloined
from an internal computer hookup at UAC Med Center in San Francisco some years
ago. Claymore had seen the file before; she was one of several agents who'd been
unable to make anything of it. Now she was intuitively certain it had a bearing
on the Holder case.
After the file contents had already been entered into the computer an attempt
had been made to alter the address codes--a remarkably successful attempt by a
mathematician of some skill. There was no longer any hope of ascertaining
RE-ENTRY
35
who had sent the memo to whom, although the fake ident codes were clearly fake,
upon inspection.
Claymore chose transcription instead of voice. She studied the words that flowed
in shadow before her eyes.
... instantaneous travel a shared illusion. One never emerges in the same
spacetime one leaves, hence those tiny shifts in the phenomenal world we
travelers have come to know so well. Are the freckles on your lover's nose
slightly askew since last you said goodbye? There are a million billion yous, an
infinity of yous, and you have a million billion lovers. What orgies of
rediscovery all travelers might enjoy, if only they knew....
A warning tone sounded quietly in the cabin. The plane was about to land.
She rewound the fileslab and replaced it in her case. She went forward and sat
in the control couch. Restraints enclosed her as she swung toward the console.
The plane banked and began to descend in a slow spiral. Below its long thin
wings lay the San Francisco Bay Conurbation, scattered tall soleris poking up
through the smog, rising from a thin crust of slums. Most of the bay itself was
covered with floating suburbs connected to the shores by a spiderweb of bridges.
The tall, complexly articulated Parnassus soteri, the city's most populous and
the seat of the Medical Center, reached up for the descending aircraft. Jets of
flame shot down and forward from beneath the plane's wings.
An idea was forming in Claymore's mind. She thought she knew what Holder was up
to.
The plane plummeted smoothly toward the Federal Offices landing pad that jutted
from one side of the vast structure at the 120th level.
Holder's stolen craft spread its wings a bit wider, cupping cool dense night
air. It dropped steeply, smoothly, through a cleft in sheer jungle-clad volcanic
peaks. Holder watched through the cockpit windows as the moonlit vegetation slid
by a few meters away, delicate as silver filligree. He marveled at the jungle's
remembered beauty, and forgot to be afraid: the lander was more than competent
to fly itself.
Soon the mountain valley opened onto a broad coastal plain, thick with shining
palms. In the distance the low round moon spread a silver path upon the sea. The
graceful, intelligent lander slowed to a hawk's lazy pace, wheeling in the
night, dropping close to waving fronds.
A wide white beach opened beneath the lender's wings, coaxing it to extend those
wings to their limit. The plane slid easily away in a curving dive that brought
it within centimeters of the sand.
From the foaming surf great dark anthropomorphic shapes heaved up on hind legs,
their webbed forefeet dangling, their shovel-nosed faces peering curiously at
the passing shadow of the aircraft. Holder was delighted to recognize the
silhouettes of anatosaurs momentarily distracted from then- ceaseless grazing.
The lander gently pulled its nose up and allowed its forward motion to stop,
settling easily to the sand on extended gear. Holder flicked off the instrument
panel lights; the green glow faded and moonlight flooded the cabin. He settled
back to wait for sunrise.
The placid herbivores in the surf were no threat to anyone, and though the
jungle hid deadly carnosaurs, Holder had no fear of them either, their behavior
was predictable. There were more dangerous bipeds in the night woods.
Best to stay put. The approach and landing had been silent; the lander had not
fired its rockets once on the entire night
36
RE-ENTRY
37
ride. Holder was confident that the particular route he'd worked out with the
aid of the tender's computer had neatly evaded Darwin's anti-poaching defenses.
He had memorized the location of every sensor installation on the planet.
Two weeks on short rations had served him well. Most of that time had been spent
under plus-one deceleration, and even within the tight confines of D-27's small
passenger cabin he'd been able to get a considerable amount of exercise,
entertaining himself by measuring his progress in push-ups and sh-ups. He was a
good deal harder and leaner than when he'd jumped from Humboldt.
And perhaps a bit saner as well. That stunt he'd pulled in the lounge the night
he'd jumped--he'd justified it to himself as a diversionary tactic: poor old Phil
Holder drunk, crazy, over the hill, passed out for the night or maybe the week.
He could have achieved the same end without displaying his raw wounds, without
leaving a testament of anguish. Perhaps he preferred to be remembered with
disgust; perhaps he'd wanted others to agree with his assessment of himself.
What he'd almost done to Bruneau had shaken him. There he could not hide behind
the excuse that his life was his own to risk if he wished.
For two weeks he'd been locked up with himself, with no means of escape except
suicide. There was no alcohol in his bag or anywhere aboard, there were no
hallucinogens or pain-tillers or tranquilizers. He was clean.
There was only The Plan, the best drug of all. "Lord, give us this day our daily
delusion." Between sane and stck, and insane and healthy, he'd take robust
madness any day.
He went to sleep.
By the time the hot yellow globe of Darwin's Star rose over the eastern sea,
Holder had already walked a half a kilometer away from the little black lander,
trailing a single set of footsteps in the unblemished sand. He heard a
fluttering whistle behind him and turned to look back at the trim, powerful
craft that had served him so well for the past two weeks.
As he watched, the metal bird came to life. Sand exploded from beneath it. It
rose straight up into the air on a searing jet of thermonuclear flame. At an
altitude of twenty meters the lander dipped a wing and turned east. It flew low
over the ocean, straight at the rising sun, gathering its wings as it
accelerated. A few kilometers from the beach the plane soared
38
RE-ENTRY
into a chandetle, screaming upward on a vertical trajectory that it could have
maintained easily all the way into free space. But it rose only half a kilometer
before pulling over into a tight hah5 loop. In seconds it was flying straight
down again, still accelerating.
Lander D-27 was a very smart machine, but with no one aboard it lacked the
instinct of self-preservation. It followed Holder's programmed instructions
without hesitation, ending its life in a mighty eruption of sea water.
Away to the south a herd of grazing anatosaurs, doubtless the same ones Holder
had glimpsed the night before, gazed impassively at the distant geyser. When the
sea ceased bubbling they went back to their feeding, poking broad ducks' bills
under the water to crop seaweed growing close to shore. Holder turned his back
on the dinosaurs and trudged northward up the pristine beach that stretched
endlessly before him.

He carried his canvas satchel and wore the clothes it had contained: khaki
trousers and jacket with flaps and straps and pockets sewn all over, a broad-
brimmed canvas hat, and stout walking boots. He was the very picture of the
well-turned-out jungle tourist.
He was headed for the mouth of the great Marsh River, a broad stream that
drained most of eastern Cretacia; although its delta lay almost fifty kilometers
to the north Holder had good hopes of reaching it before nightfall. Darwin's day
was long (the terraformers had seen to that), and the coarse beach sand provided
good footing, not like the powdery coral stuff found on the stormier shores of
tropical Earth. Except for a few streams flowing into the sea which Holder would
have to wade, there were no major obstacles between bis present position and the
estuary.
There he would pick up bushbuggy traces that eventually wove themselves together
into a rutted, single lane road, paralleling the river and leading thirty
kilometers inland to Copeville, the major port on the Marsh,
He would have to spend a night alone in the swamps. After that it was only one
more short day's walk before he began to change the shape of history.
"Citizen Jerome?" the maitre d' inquired politely.
"That's right," Susan replied.

"Officer Claymore is waiting for you on the terrace. If you'll Step this way
..."
Susan trailed the obsequious helot through the crowded dining room. This
Claymore must throw some weight, thought Susan, to rate an outside table at this
hour, in this kind of weather.
The day was warm, so warm that the restaurant roof had been rolled back.
Claymore's table was on the very edge of the deck, where one could look down the
sheer sides of the ancient, weather-beaten soleri to the landscaped slopes of
Mount Parnassus far below, and on out over San Francisco's endless blocks of
shim shacks, a grayish-white vista relieved only by the huge stained oblong dome
over Golden Gate Park. In the distance, the ocean and the bay glittered in the
brown haze, and a few kilometers farther to the north, beyond the rusted broken
teeth of the Bridge, the outline of the Tamal-pais soleri was vaguely
discernible in the murk.
"Here you are, Citizen," said the helot.
"Thank you," Susan said to the man. Most doctors would have insisted on the use
of their title, thus humiliating the easily humiliated creature, but Susan was
content to be called Citizen, and she insisted instead on treating helots as if
they were human beings--though she doubted they noticed.
Claymore was standing. She extended a hand graciously. Susan shook it
perfunctorily.
"You're much younger than I expected," Susan said bluntly.
Claymore smiled, showing perfectly even teeth in a heart-shaped face. Susan
enviously noted that the government agent was wearing a fortune in genuine
cotton and leather, all in the finest taste. The two women settled into their
chairs,
39
40
RE-ENTRY
assisted by helots. The headwaiter presented Susan with a menu tab, then bowed
and left. Rather obstinately, Susan said nothing, waiting for Claymore to start
the conversation-- after all, Claymore was filthy rich, one of them. Beautiful
besides, the eyes especially, dark and liquid ...
Susan blinked. "Pardon me for staring," she said. She'd spoken first after all.
"I must seem terribly rude...."
Claymore smiled again. "But you're not at all sure you approve of me, is that
it?"
"Since you mention it." Susan felt inadequate to the demands of the interview,
conscious of her own imitation silk suit, her rather thin, pale, unusually
blonde looks.
"I have no intention of seducing you into liking me," Claymore said, with what
sounded like genuine sympathy. "I asked to meet you here only because it is an
exceptionally fine day, this is an exceptionally fine view, and this is my first
visit to San Francisco. I admit to combining business with pleasure whenever
possible."
"I can hardly argue with that," said Susan.
"Good. Why don't you order? And then we can talk.**
Susan nicked off a number of items on the menu tab, sparing the government no
expense. She knew the vegetables here were crisp and fresh and frightfully
costly. A silent waiter appeared just as she held out the tab, taking it in a
gloved hand and soundlessly disappearing.
"Will you join me?" Claymore asked, indicating the bottle of white burgundy
cooling in the silver bucket beside her chair. Indeed Susan would. As they
sipped, Claymore explained the purpose of her trip, concluding, "Naturally, we'd
like to close the matter as soon as possible."
"I'm surprised there's any question in your mind," Susan replied. "The news
people all seem satisfied it was an elaborate suicide." .- "And you?"
"Phil behaved in a classically self-destructive manner for years, there's no
doubt of that. Frankly, I got sick of wiping up his messes." Susan paused,
looking at Claymore. For no reason she could put her finger on, she decided to
trust the woman. "You know we were lovers? For awhile at least I assume you know
that"
"Yes."
"It was after his second wife was... died. I knew diem both."
RE-ENTRY
41
~ "We have the public facts, Susan," Claymore said gently. **By the way, my name
is Angelica."
Oddly, the proffered intimacy seemed neither out of place nor premature. Susan
accepted gratefully, looking into Claymore's remarkable eyes. "He was
extraordinarily sensitive, so sensitive sometimes I actually thought he was
reading people's minds. Reading my mind. He used to get upset when Td say that,
though." Susan paused, remembering. "I'd get a lecture on how all you had to do
was watch people, their eyes, their reactions to other people--with that and a
little data about their pasts, you could fill in the rest. Even the broad
outlines of their future." .. "That must have been useful in his profession.*'
"It wasn't just professional, Angelica. It was almost as if he couldn't help it"
"What happened between you?" Claymore asked softly. The warm breeze of the early
June afternoon stirred her chestnut hair. Otherwise she did not move, fixing her
gaze on Susan.
"I just got tired," Susan answered. "Tired of his drinking. Tired of his other
women--his little girls. Tired of his despair. He seemed to think the past had
condemned him. He talked about it all the time. His first wife. His son. His
second wife. I tried to sympathize, but after a while... after I got tired of
hearing him talk, nothing else seemed worth putting up with."
"So you broke off with him?"
Susan nodded. "Not that it did any good. He'd still collapse on my doorstep
whenever he was in trouble." She sighed shortly, glaring around. "I hate these
damn soleris sometimes, don't you? You can never get away from anybody."
"They were a good idea once, when they made a little more space. I'm afraid weVe
run out of that."
Susan dropped her gaze, ashamed. "Maybe I shouldn't complain." Her gaze nickered
to the edge of the balcony. "After all, what if I weren't in the ninetieth
percentile? I'd be living down there ..."
Claymore looked at Susan sympathetically, encouraging her to go on. "Was there
some particular time-^-some specific incident--that made you suspect Phil might
have decided to kill himself?"
"Oh, that was always a possibility, right from the beginning." Susan stared at
her. "It was kind of a bitter joke
42
RE-ENTRY
between us--he'd accuse me of putting up with him only because I'm a
pathologist."
Claymore arched her eyebrows. "I don't..."
"Of waiting to get my hands on his corpse," Susan specified, embarrassed.
"Not exactly Attic wit," Claymore said coolly.
"He was usually drunk when he said it." She sighed. "After I stopped seeing him
it got worse, if possible. For months. Worse and worse and worse. I was even
considering..." She stopped, swallowing.
"Susan?" Claymore asked with concern.
Susan's eyes were closed, as if she were holding back tears. "Well, he was just
getting so awful. I was getting so desperate. I... I almost called Security.
Even though ... you ..."
"Even though you were afraid we'd 'burn him,' " Claymore finished for her.
"Oh, I know you don't do it unless they ask for it," Susan said bitterly. "But
how do they know,..?" Susan's eyes strayed.
Among the neighboring tables in the busy restaurant glided attentive helots,,
polite, competent, wholly devoid of pride. At some time in the past each of them
had voluntarily sought brainburning, with its guarantee of government
maintenance for the duration of one's natural life, its assurance of pleasant
work, neither interesting nor overly strenuous, its promise of release from past
associations, from squalor, from pain, from ambition.
"However, you decided against reporting Phil," Claymore prompted.
"He changed. It was about two years ago now, I guess. I only saw him a few times
during that period. He seemed incredibly busy, driven almost. He made two trips
outside the solar system, maybe three. And be stopped drinking, or at least, he
stopped getting drunk. And I think I know why ..." Susan stopped again, aware
that what she was about to say would sound foolish,
"Please go on," said Claymore.
"Somehow he got hold of the idea he could go back to his past. That he could
make it right."
"Go back? Time travel?" Claymore smiled.
Susan blushed. "It sounds crazy, doesn't it?"
"It does seem pretty far-fetched."
"WeO, I dont believe it myself. But I think Phil did."
RE-ENTRY
43
Susan looked seriously at Angelica Claymore. "He may be dead, but whatever he
was doing out there that night, he wasn't just giving up." She paused. "Somehow
it's important to me for you to know that."
Claymore said nothing.
If Susan could have read Claymore's mind--as Phil Holder might have, or as
Claymore read Susan's--she would have been appalled by what she found there.
But Claymore weighed Susan's last words, and decided Susan was sincere when she
said she didn't think time travel was a real possibility. Therefore Claymore
decided to allow Susan to go on thinking.
"At last! Here's our food," said Claymore, as the helot brought a large silver
tray. Claymore raised her wine glass in Susan's direction. "Doctor, to your
health."
"By now Tanner knew that her daring experiments, using herself as subject, had
been unequivocally successful. Over a ten-year period she had continuously
plotted over two dozen functions of the body, on every level from cell membrane
ion exchange to blood oxygen absorption, and at every level she found the same
result: no change over time. She had gone far beyond the work of her
predecessors. She had not only slowed the aging processes, she had stopped them
in their tracks.
"There was one exception to the otherwise cheery picture: she was sterile. Her
ovaries had not produced a viable gamete in a decade, and she knew they never
would again. The primitive medical techniques of the period could not alleviate
her resulting depression. She disappeared from public view, and never published
a word of her findings.
"In retrospect, we know that it was sometime
44    RE-ENTRY
during this period that Margaret Tanner relinquished the name she had been born
with. Many years later and many light-years away from Earth we are able to
resume the story of Clarissa Sirich, now living under the name Elizabeth
Tanaka.,.."
(from Darwin: A Millennium of Conservation)
Before Darwin's Star there was Bounty's Star. Before Darwin there was Bounty.
Before Bounty there was nothing but a barren rock circling WSC 1228, the one
thousand, two hundred and twenty-eighth star identified by the old Project
Cyclops' Whole Sky Catalogue as a single star of clement temperature with a high
probability of possessing planets.
In and of itself the rock was ugly, but a couple of traits made it interesting
to speculators in planetary real estate. Its mass was only a few thousandths of
a percent less than Earth's, and though its sun was hotter, a G-0 rather than a
G-2, its nearly circular orbit had a mean radius just enough greater than an
Astronomical Unit that its solar flux was nearly identical .to Earth's.
The rock bore no life, but its surface was lively. Chains of volcanoes spewed
gases into an atmosphere already thick with carbon dioxide and ammonia. Crustal
plates collided and shook (ever so slowly), creasing the face of the land.
The rock's barren oceans lay torpid under a warm sun, unstirred by the tides of
any moon. Given a few billion years, life might have arisen. But probably not.
Busy men rendered the question meaningless. A large icy comet, nudged from its
path by fusion charges, smashed into the rock with such titanic energy that the
rock's axis and spin were readjusted. The comet's leftover chunks sped off into
a million directions, but one large piece settled into orbit around the planet,
providing it with a bright and perfectly serviceable moon.
Microorganisms tailored to the purpose were strewn liberally across the surface
of the planet. The reaction was explosive: they ravened upon the carbon dioxide
in the air and the carbon dioxide dissolved in the water; they died in
prodigious quantities, releasing oxygen, taking carbon with them as they went,
in a mineral precipitate that rained heavily upon the ocean floors. The
terraformers murdered the carbon
RE-ENTRY
45
fixers before they could go too far; they wanted an atmosphere with an excess of
CO2-
Meanwhile, different strains of laboratory-bred life had been debauching
themselves on the nitrogen-rich compounds in the atmosphere. By the time they
had poisoned themselves in their own waste they had helped convert the air of
the rock to something resembling Earth's, four parts nitrogen to one of oxygen.
Plant forms followed, hi forced succession--mosses, lichens, grasses, bushes,
trees. Living and dying under hothouse conditions, their wastes and remains
built up a thin layer of soil where once there had been only sterile rock and
sand.
Just one century passed. The handmade life forms created a planet with-a
foreordained destiny: to be Earth's breadbasket. Crops were planted in fields as
wide as continents. There were grains and fruits and vegetables and fibers, and
grasses and legumes and animals to graze on them. There were spices and
aromatics, coffees and teas. There was sugar, and there was milk, and honey. In
the sea were fishes and shellfishes and crustaceans, and on the mountainsides
timber and managed "wild" game. And in the huge greenhouses were a thousand
varieties of flowers, mushrooms, what-have-yous, experimental tidbits never
conceived by God or Mother Nature.
The rock was christened Bounty. Its flag was the cornucopia.
Earth grew fat and her well-fed billions multiplied.
Among Earth's complacent citizenry a few adventurous souls (not many)
complained. They were cheerfully assisted on their way to colonize the living
planets of other stars, planets with evolved ecosystems of then- own. There they
found adventure aplenty; though humans had nowhere yet found or recognized
intelligence, alien life sometimes fought back vigorously nonetheless.
But Bounty, Earth's creature, did not resist those who fed upon her.
They never found out where the bugs came from, or why so many kinds showed up at
once.
It started with a few varmints that resembled army worms, in a small corner of a
big cotton field. The local administrator
46
RE-ENTRY
of the Fiber Board was incensed at .what he took to be a personal affront. He
had the plants sprayed. The pesticide worked; the pests disappeared.
Next growing season there were six new species of cotton-eater. The combination
of chemicals required to kill them was quite effective. It also killed all the
fish and shellfish along the adjacent coast.
Before anyone knew what had happened, or could check the wild oscillations of
chemical death versus mutant life, a devil's bestiary had attacked the com, the
wheat, the rice, the cows, the pigs, the sheep ...
Hysteria spread like a prairie fire. There were anguished screams of "sabotage,"
and indeed, horrible subversive things were found in some private homes: here a
potted geranium, there an African violet People were dragged out and lynched.
There were other theories about the source of the disaster: that a shuttle
illegally flushed its tank in the atmosphere, or that the bugs came from space
itself on a carbonaceous meteorite, or (the most likely explanation) that they
had escaped from Bounty's own laboratories. But no single organism, whether
nucleated or non-nucleated, one-celled or many-celled, could have spelled the
planet's doom.
That doom was swift, ghastly--the genetic simplicity that had allowed Bounty to
be born within a single century now spelled her death hi a tenth that time.
Several hundred thousand people died, eighty percent of the planet's entire
population.
On Earth the fraction was the same. The numbers were unimaginable. And following
the deaths due outright to starvation, Earth endured another decade of bloody
political upheaval. The New Era was ushered in amid the smoke of a billion
funeral pyres; they had burned unquenched for years.
Neither Earth nor Bounty had the will or the means to communicate with the
other. Bounty gained unsought independence. On Bounty a new leadership arose
from the wreckage, determined to learn the lesson of the holocaust Eloquent
among them was Elizabeth Tanaka, a senior biologist with Central Laboratories,
Ceres, the same continent that first noticed the infestation of pests. Tanaka
seemed a youthful forty-five or so, an age that would have been confirmed if
anyone had consulted the records.
As leaders of the remnant debated their future course,
RE-ENTRY
47
Tanaka stood forth and delivered a stirring and ultimately decisive address.
From remarks of Citizen Elizabeth Tanaka, Fourth Session. Chamber of Deputies of
the Unified Provisional Government of Bounty, on the first day of Primavera,
2180 O.E. (1 N.E.):
"We are guilty of hubris, not against any god, but against our own deepest
nature. We have forgotten that we are creatures of the natural world, and that
all our skill and understanding is as nothing compared to the wisdom inherent in
five billion years of blind evolution.
"We must seek our own forgiveness. We must seek to rediscover and recreate the
natural order that gave us form, that our pitiful pseudoecology of monocultures
has mocked. Though we can create almost any living form we desire, of our own
knowledge we can make nothing capable of survival. Only by reconstructing the
natural world we have destroyed, reconstructing it in all its complexity
throughout time, can we hope to learn again, humbly, what willfully we have
forgotten.
"The name 'Bounty' and all the eager exploitation it implies must be wiped from
human memory. We must create a new world that honors the processes of nature,
the most basic of which is selection.
"We must find a new name to express the deep and subtle understanding we seek,
the principle that only the life that is fitting can ultimately survive..."
8
Holder was in luck. He grinned to himself as he bounced a few centimeters into
the air and came back down again*
4S
RE-ENTRY
hard, on the steel flooring of the speeding utility buggy. Everything around him
bounced in unison: the rusty tackle, the beat-up electric outboard motor and its
fuel-cell battery, and the big smelly primitive-looking fish, half teeth, that
lay against the buggy's tail gate. Holder was not at all sure the tenacious
beast had given up its hold on life; that was one reason he preferred to ride
backward at the other end of the truck bed where he could keep an eye on the
carcass.
His position had other advantages. Through black ink strokes of jungle shrubbery
brushing past overhead and all around him he could see the glimmer of the full
moon sailing up from the east. Even as he watched, the shadow of a pteranodon
glided across the face of the moon. And in the cab behind his back his
benefactors had at least the illusion of privacy. The boy driving was twenty at
most, the girl beside him a freckled and sunburned sixteen. Holder hoped that
between them they'd manage to keep one hand on the wheel.
He wasn't sure how much of his story they'd bought, the tall tale he'd made up
about being lured downriver by a con man and robbed and abandoned, though he'd
given them a perfect description of Widefoot Willy, an infamous river rat they'd
have recognized. Whether they believed him or not didn't really matter, because
if be wasn't a tourist doing a little unauthorized sightseeing (grounds for
deportation on Darwin) he was some kind of equivalent outlaw--an off-world skin
buyer, maybe. The kids knew he wouldn't be complaining to any Rangers, or
talking to anyone about an illegal fish in the back of the six-wheeled buggy.
Holder grinned again, as the buggy walloped through another pothole. He'd saved
an entire day--what luck! Even though he wasn't exactly sitting in the lap of
luxury, it was better than a sharp stick in the eye, as they said in these
parts.
They reached the outskirts of Copeville an hour before midnight. The bushbuggy
turned off into a narrow back street leading toward the water, then stopped.
Holder clambered down one of the big rubber tires and turned to thank the young
Samaritans.
He was taken by the girl's frank brown stare. She gazed at him from the shadows
on the far side of the cab with a
RE-ENTRY
49
smoldering look that seemed to tender the elemental secret of life.
Remember your age, Holder.
He tore his gaze from the girl and stepped away. The boy saluted and flashed a
mouthful of white teeth; he wheeled his long buggy around in the middle of the
road in a centipede's version of a U-turn and barreled off into the moonlit
scrub.
For a long time Holder stood alone in the humid night, smelling the heavy
perfume of a thousand magnolias, listening to the ratcheting drone of countless
frogs. Yellow light spilled across the road from the windows of Whitney's Place,
the infamous smugglers' lair. The light projected a shadow play of dancing
insects.
Holder walked across the dirt road and up onto the plank porch, which was raised
high above ground level to accommodate the Marsh's frequent floods. Whitney's
was long, low, and narrow; four people with arms outstretched could reach across
it from back to front. That left plenty of room for weekend dances. Though there
were screen doors at both ends of the half-block-long porch, Holder knew he must
walk the length of it to the door nearest the bar, so the people inside would
have a chance to look him over through the screened windows as he approached.
Otherwise he could get himself killed by mistake.
He watted slowly, his heels knocking hollowly against the boards. At the thought
of coming face to face with Whitney he was taken with a sudden shyness. For the
first time he was about to meet someone he knew, not as that person would be in
Holder's "now" but as he had been in Holder's "then." Nothing he had done so far
in this mad enterprise had so filled him with apprehension.
He took a breath and pushed the creaking door open against its rusty spring.
Whitney was not in sight. Two muscular young dock hands sat hunched over beer
glasses at the far end of the bar. One was watching him; thinking he recognized
a tourist, he sneered and turned back to his glass.
Farther back hi the shadows of the long empty dance hall two older men and a
woman played dominoes by the lurid red light of a plastic tyrannosaur, which
hung on the un-painted boards of the wall behind them. The beast was rampant,
clutching a can of "Dragon's Milk" beer.
50
RE-ENTRY
Holder smiled when he saw the illuminated sign. He remembered staring at it for
long fascinated minutes the first time he'd come into Wbltney's, clinging to his
father's hand. He'd been five or six years old then, and had not yet seen a live
tyrannosaur.
Holder didn't have time to examine the bar's last customer, who sat alone hi the
dark, for just then Whitney himself emerged from the storeroom behind the bar.
It was Whitney all right, long and stringy as a piece of jerky, just as Holder
remembered him. Despite Holder's earlier fears, that seemed just as it should.
Whitney stopped when he saw the stranger. He stared guardedly from under
beetling, gingery brows, then moved to wipe his hands on the seat of his
trousers. Evidently he decided that Holder was not an undercover Ranger (not
even a fink would lower himself to dress like a tourist}, for when he brought
his hands out from behind his back he held no weapon.
"Evenin*, mister," Whitney said, almost whispering. "Want somethin'?1,'
Holder hitched himself onto a bar stool in the folksy manner of a tourist
imitating a local. "How about a beer?" he suggested cheerfully, pushing his
broad-brimmed safari hat to the back of his head.
"We got Dragon's Milk, 'n we got Palm," Whitney croaked.
Before he could answer, Holder heard a heavy footstep behind him. "Do ask for
Palm, for Gawd's sake," drawled a loud voice.
The men at the bar turned, reacting with undisguised contempt, curious to see
how Holder would respond to a character they knew well. But the hairs rose on
the back of Holder's neck. The voice was unmistakably familiar, a fruity British
accent Holder happened to know had been acquired in Saint Cloud, Minnesota.
He had not expected and had not wanted to hear that voice for at least another
day.
Holder wheeled around on the bar stool. A florid fat man stood before him,
sweating profusely. Holder knew the face as well as his own: shiny cheeks,
matted red ringlets of hair, lips of baby Eros. And so young! Thirty, at most.
Somehow Holder had not been prepared for that--he'd always thought of this man as
much older than himself.
The ersatz Britisher stared back at him. "Awfully sorry,
RE-ENTRY
51
my good fellow. I'd no intention of giving you such a fright.** He moved toward
the stool beside Holder's, then hesitated. "D'you mind?"
Holder recovered. "Not at all. Please."
The fat young man draped his ample bottom over the stool and leaned toward
Holder familiarly. "Dragon's Milk, indeed,'* he harrumphed. "Dragon's piss, more
likely. At least Palm's drinkable."
Holder turned back to Whitney. "Palm it is."
Whitney reached into the cooler and pulled out two bottles of Palm. "Four
cents," he "hissed, holding fast to the bottles.
The fat man stared at the bottles, flicking his tongue over rosebud lips. Then
he fumbled in the pockets of his jacket "Here somewhere, quite certain of that."
"Allow me," Holder said, after a slightly indecent pause. He handed Whitney a
plastic blank yellowed with age.
Whitney took it suspiciously, still clinging to the sweating bottles with one
hand. The blank looked positively ancient, though it bore contemporary edge
markings. Meanwhile the fat man had instantly stopped searching his pockets. A
look of relief spread over his shiny round features. "I say, that's really too
good of you...."
"I know," said Holder, reflecting that he had indeed learned a lot from this
man.
To Whitney's evident surprise the aged piece of plastic was perfectly
legitimate. His bar terminal registered four cents.
"... and I do appreciate it," said the fat man. "Unwin's the name, T.T. Unwin.
And yours, sir?"
Holder took the credit blank from Whitney and-shoved it back in his blouse
pocket. "What's the T for?" he asked
"Which TT* Unwin asked defensively.
"Either. Both."
"My father was a classical scholar," said Unwin with a sign. "Oxford, you know.
The full name is Telemachus Teucer Unwin."
In spite of himself Holder grinned sadistically. "Named you after a couple of
Greek archers, eh? Tell me, T.T., does your shaft always hit the mark?"
Unwin looked acutely uncomfortable. In a very low voice he said, "Don't tell me
that my face has, aah, spread itself before me?"
"People say I'm a regular mind reader."
"It is indeed a pleasure to meet another cultivated man,
52
RE-ENTRY
I must say." Unwin attempted a smile, but only managed to appear shifty. "But
you really do have the advantage of me,
sir."
"Smith. John Smith. Why don't you call me Smith?" Holder
extended his hand.
Unwin took the proffered hand with limp enthusiasm. "As you will--Mister Smith."
The touch of Unwin's moist flesh gave Holder an indescribably queasy sensation.
He snatched his hand away and wrapped it around his beer bottle. Both men drank.
Both were practiced at it; before the bottles hit the bar again half of each had
disappeared. Unwin was right about the beer, thought Holder. He'd forgotten how
good Palm was. And he'd earned his today.
Now what in the world was he going to do about Unwin? Damn it! What was Unwin
doing here early? "What brings you to Cretacia, T.T.?" Holder asked, awfully
casually.
"Pursuit of learning, Mister Smith." Unwin sniffed. "You see before you a
wandering scholar, a student of human nature, not to mention many abstruse
disciplines both philosophical and, especially, mathematical." Unwin belched,
then sighed. "Also, alas, practical... from time to time I am forced to seek
sustenance in the form of a paying job." Unwin sucked thoughtfully on his beer.
"Any immediate prospects?"
"Why yes, in fact." Unwin sounded pleased with himself. "Chief Ranger Holder has
advertised for a tutor for his lad. A most compassionate father, that--doesn't
want to banish the boy to a boarding school. I caught wind of the offer, and
wired the man a vitae from my hotel in Cuvier. He was impressed, of course. In
turn he invited me_for an interview-- wired me passage, too."
"Congratulations," Holder said mechanically. He knew it all to the letter. He
knew the name of Unwin's hotel in Cuvier, and he knew that Unwin's
accommodations there consisted entirely of a message-intercept service provided
by an epicene desk clerk whose flat Unwin was sharing.
What was the man saying?
"... airship here, and by boat to Waterhouse tomorrow. Then, assuming all goes
well, thence to Holder's jungle stockade, or wherever he lives, on the day
after."
'Tomorrow?" Holder looked at Unwin with surprise.
"Ghastly business, what? But one must eat"
RE-ENTRY
53
"You're going to Waterhouse tomorrow?" Holder repeated.
"Quite so," said Unwin a bit suspiciously. "If I may be so bold, Smith, what's
it to you?"
"What's today's date?" Holder blurted.
"Why, the fourteenth of Tri, I believe. Oneday night." Unwin glanced at his
wrist unit. "Almost Twoday morning, actually."
Seeing the fat man's puzzled expression Holder realized he'd better make some
excuse. "The river boat runs tomorrow, does it? Must have heard them wrong at
the hotel-- could have missed the trip." Holder took a long swig of beer, trying
to hide his confusion. The dates were right but the events were in the wrong
place; there was a definite discrepancy, unless he'd made some error in his
historical reconstruction. Unwin was not even supposed to arrive in Copeville
for two more days.
"So you'll be going to Waterhouse too?" Unwin asked. 'They say it's posh. Rather
wish I was staying on... not striking out for the interior right away."
Wistfully he swallowed the remaining quarter of his beer, then turned a hopeful
eye on Holder's.
Holder polished off his bottle. "It's late," he said sternly, banging the empty
bottle against the bar. "Time to get some rest. HI walk you to the hotel."
'That really is too kind," Unwin mourned.
Holder stood up and without a backward glance walked out the door.
Whether because of Holder's commanding voice, or (more likely) because of his
own temporarily depleted resources, the pudgy Unwin waddled after him.
Holder heard Unwin come out behind him, and he could feel the baleful eyes of
the denizens of Whitney's, staring at the backs of both their necks.
... requires you urgently pursue line of inquiry outlined by your communication
earlier today. Recent top security investigations at FRAME Corporation and
elsewhere (pertinent sections appended below) confirm theoretical feasibility of
travel mode you suggest. Consider Holder possible Darwinian agent. Note
Darwinian fascination with history, per SecServ whitefile appended below. Be
aware of possible extreme danger to the status quo. Speaker Macklin requires you
report progress twice daily.
This is a big one, Angel. Ted is depending on you for this one.
Best, Bicknell
Appendix One: biographical data, suspect Unwin (per ref. S. Jerome int, this
dale) ,..
Professor Telemachus Teucer Unwin tugged at a lock of his curly grey hair (it
retained a tinge of copper still) and sucked in his rosebud lips. His cheeks
were stilt cherubic, though his sixty-plus years had spread a fine net of
wrinkles across them, and his eyes gleamed with a sly look that time had
accentuated, not softened.
Angelica Claymore watched him with her own dark, steady eyes. She seemed willing
to wait as long as it took for him to begin talking.
Despite his acute sense of danger, Unwin could not help thinking that Claymore
bore a remarkable resemblance to the Mona Lisa, at least in this setting. She
was seated in perfect repose, her hands folded in her lap, while behind her the
tall tinted windows of the Medical School library admitted a pearly light,
nicely balanced by the light from
54
RE-ENTRY
55
.the interior fixtures. Through the fiftieth-floor windows one could see a
distant landscape of sea and headlands, rendered painterly by the smoky glass.
Unwin let a little puff of air escape his pursed lips. "There's a saying that
was common in the late Industrial Age, Officer Claymore, that perfectly
expresses my personal philosophy."
"Yes?"
" Td rather have a bottle in front of me--than a frontal lobotomy.'"
Claymore smiled. "You have nothing to fear. Professor."
Unwin sighed. He didn't believe her for a moment, but what could he do? His only
hope lay in cooperation. "Poor deranged Phil Holder," he began, turning his sigh
of resignation into one of feigned regret. "He did talk to me on a number of
occasions before his final excursion, though I must stress that we were not
close friends, not by any means '--frankly, I think he never did like me--and of
course I'm delighted to share the contents of those discussion with you, an
authorized representative of the Federal Government. But I would be most
distressed--indeed, devastated--if you were to confuse Holder's mad ideas with my
own rather, aah, mundane views."
"The Persian messenger syndrome, is that it, Professor?"
"A frightened man is not a reliable witness."
She was still smiling, but her words weren't friendly. "You suggest I spare your
brain, for the sake of accurate information."
Unwin spread his fingers and shrugged. But damn the woman I
With a pointed fingernail Claymore probed the intricately embroidered pattern of
her genuine silk jacket. "What is an appropriate ransom for a man's mind?"
What indeed? "Your assurance, at least..." Unwin began.
"You have it," she said quickly. "As a representative of the Federal Government,
I am of course bound by the Constitution, ..."
(What the hell does that mean? Is she mocking me?)
"... so please tell me everything you have to say, Professor." Incredibly, she
was still smiling.
He had hoped to make her drag it out of him, thus increasing tiie apparent value
of the information. But just then she looked at him in a way he could not have
described. He felt an urge to talk.
55
RE-ENTRY
"Time travel!" he blurted. "That's what Phil was trying to do. Travel back in
time." (Therel That should give her something to think about.)
Claymore's left eyebrow lifted slightly, but her smile never wavered.
Desperately, Unwin rushed on. "He didn't mean to go far, about thirty years,
only back to when he was a boy of thirteen. Why was he doing it, you ask?" (She
hadn't, but he knew she would.) "I'm not sure quite how to put it. He wanted to,
aah, he wanted to prevent himself from living the life he has, hi fact, led."
Claymore continued to watch him calmly, but for the first time the smile slipped
and the faintest look of puzzlement creased her brow. "You mean growing younger,
recovering his youth?"
"No, that's impossible." Hastily he added, "I mean, that's even more impossible.
I mean, he didn't believe that was possible." Unwin stopped for breath. "He knew
there would be two of him," he resumed. "He wanted to find himself as a boy,
and, aah, influence that boy. That earlier version of himself."
Claymore's smile at last disappeared altogether.
Unwin was encouraged, "Perhaps I was mistaken when I assumed your omniscience,
Officer? Did you know I was Holder's tutor when he was a boy?"
"I know that. I know quite a few things about you."
"Mmm, no doubt. But that was the point of his journey, don't you see?"
"What point?" Claymore demanded.
"He's fired me in retrospect!" Momentarily Unwin forgot his fear. He chuckled.
"He's gone back to do the job himself. He thinks he can do it right!"
Claymore was silent, brooding.
Unwin was unsure what he'd said that had unsettled her. She'd showed no surprise
when he'd mentioned the concept of time travel itself.
Finally she spoke. "Fm afraid you'll have to do better, Professor."
"Better?" He was sincerely surprised.
"No one would go to such lengths just to alter his personal history.**
"But people do it all the time," Unwin protested. "Vicari-
RE-ENTRY
57
ously, anyway. Those who are allowed to have children try to live their lives
over again through them, I mean."
She ignored this. "What could the man have done, so evil that he became obsessed
with undoing it?"
Unwin shrugged. His eyes wandering to the galleries where students studied with
earphones and projectors, lost in worlds of their own. "True, Holder's share of
evfl seems as banal as most. One can scarcely imagine it living after him.
Nevertheless, it is not inconsiderable. Whose is?"
Claymore's eyes flashed. "Don't waste my time with riddles."
Suddenly Unwin was terribly afraid. Something told him Claymore was in an awful
hurry, her seeming calm notwithstanding. Brainburning might be the lesser of his
worries. He made up his mind to tell her everything she asked; he leaned toward
her and spoke rapidly, sincerely. "Holder believed he doomed everyone he cared
about; that's what drove him. And he had reason! His second wife, that's what
started him thinking about it--they were trying to decide whether they could live
through a second triad, and they'd decided they could". They went to Amor on a
second honeymoon, to celebrate. The first night they were there they argued
while out walking. He headed for a bar, she started back to their hotel. She was
murdered. The motive was robbery, presumably.*'
A look of distaste crossed Claymore's face. *'How do you know this?"
"I... everybody... he told me," Unwin spluttered. "He told me all about it. It's
what started him wondering about what happened to his first wife." Unwin raced
on. "She was, to put it bluntly, deranged. A simple organic problem, most
likely; no one will ever know. Holder refused to recognize it--well, he was
hardly more than a boy. But his wife and baby son disappeared hi the wreck of
the Griffin, while he survived. Holder told me he was sure she was the one who
was responsible for the wreck." Unwin broke off.
There was a strange expression on Claymore's face. *The Griffin? Holder's wife
was on the Griffin! With Ruiz? And Ted Macklin?"
Unwin could only nod, captivated by the intensity of Claymore's stare.
"And he thinks she did it... ?'*
55    RE-ENTRY
Unwin stared back at her.
Claymore leaned to her briefcase and came up with a file-slab. She held it close
to Unwin's face and pushed its stud; a reedy voice issued untranscribed from the
miniature speaker: "... one never emerges in the same spacetime one leaves.. "
Claymore spoke over the voice from the slab. "If you want me to spare your
precious brain, Professor, help me find out whose voice is on this slab. And
fast."
Unwin licked his lips. "As you wish, Officer. I place myself under your
protection."
70
The faarsh Queen skittered down the launching ramp, rubber skirts aflap, and
floundered noisily onto the broad bosom of the river. From the shallows a family
of titanosaurs watched, munching on vegetation plucked from the swampy shore.
With their long necks arcing in concentric curves, the family of sauropods made
a considerably more graceful sight than the old hovercraft, until at last the
craft picked up enough speed to skate swiftly and surely away across the surface
of the water, heading downstream for Copeville.
From the top floor balcony of Waterhouse, a kilometer from the wharf, Holder
watched the riverboat leave. A few small groups of tourists shared the wide
observation platform with him, but they were far more interested in dinosaur-
spotting than in the departing boat. Only one man, darkly bearded and flashily
dressed in Eridanian silks, seemed unimpressed by the scenery; he seemed more
interested in Holder, but looked casually away when Holder glanced in his
direction. Holder had never seen him before, and paid him no attention.
The resort hotel stood high on polysteel posts cast to imitate great tree trunks
a dozen meters tall, high enough to raise it up among the real trees and above
the stagnant hu-
RE-ENTRY
59
midity of the swamp. As far as Holder's eye could see, green trees draped with
vines towered among still pools of water. The pools reflected a soft blue sky
with scattered downy clouds. The flat world of water and plants stretched away
on all sides; only to the west was the horizon broken by a string of eroded
volcanoes. Beyond them, higher and hazier still, stood the immense cone of Mount
Owen, crowned with a column of smoke and steam, a perpetual shadow against
heaven.
Holder shaded his eyes and peered west, into the glare of the late afternoon
sun. From the gorge of the Marsh, where it bent north to skirt the great
volcano, Chief Ranger Alexander Holder, Administrative Director of Upper and
Lower Cretacia, would soon be coming downriver to meet "T.T. Unwin.**
Getting rid of the real Unwin had, happily, proved to be as easy as Holder had
hoped, despite the upset caused by the anomalous slippage in dates. That first
night, on the road between Whitney's and the Copevflle hotel, Holder had socked
T.T. with a one-two punch. Blackmail first--on Darwin, a planet obsessed with the
reproductive function, even a hint of same-sex preference was cause for
ostracism.
... years in the most primitive, reptile-infested area of the whole primitive
continent. No cultivated companions. Ranger Holder's a bluff, hearty type, not
your sort really, and gone most of the time anyway. And his wife h worse: dull,
and a savage moralist. Five years in the jungle! And only the boy to keep you
company... Frankly, Unwin, Tm surprised you were--will be, that is--able to resist
temptation for as long as five years...
And second, bribery--using a significant portion of Holder's last research grant,
perhaps a megacent's worth of credit recorded on a thin sliver of blue plastic.--
I told you it was a perfect crime, Unwin; it won't be committed for another 30
years yet--
"Thafs ridiculous," Unwin assured him, but he'd pocketed the sliver anyway, and
by now he was on his way to Epsilon Eridani, a rich if thoroughly confused,
young man.
Far off on the silvery river Holder detected movement, a black dot skimming the
water at high speed, spreading a thin rapid wake behind it: the airboat
60
RE-ENTRY
The airboat would take at least an hour to reach Water-house. Holder ran his
tongue over lips that suddenly felt dry. He'd been good about alcohol for an
incredibly long time now, hadn't he? But every once in a while the thirst hit
him--as now, with his father on the way. Already in sight, in fact. A father
younger than himself.
The thought made his head reel. Not the thought, really, for he'd contemplated
the situation often enough; it was the awful imminence ...
He laughed aloud, suddenly, nervously. After all he'd been through and done, to
get drunk and flunk the interview!
He glanced around to see if anyone had noticed his lapse of self control, but
the tourists were all gathered at the far end of the deck, exclaiming at the
sight of a group of dome-heads wallowing in the shallows. The black-bearded man
was casually studying the clouds.
Holder could wait. By the time the airboat docked and the Ranger made his way to
the hotel it would be getting on toward sunset. His father had never minded a
drink.
Yes, he'd wait. He'd think about something else until then.
**. .. from the point of view of someone left behind, a ship falling into a
black hole is falling into the future. It doesn't look that way, since the light
returning from the departing ship is violently red-shifted, just the \vay
ancient distant objects are red-shifted. But in fact the hole's gravity
accelerates an infalling object to near light speed. As velocity increases,
time--relative to the observer left behind--dilates. And if that ship were to
return ...
"... we observe that ships and radio messages make black hole transits
frequently, yet manage to stay loosely within a 'present that can be agreed upon
by Earth and Darwin and Ichtiaque and Epsilon Eridani and Brindle and Tau Ceti
and all the other worlds of the Starry Archipelago. Fast ships.
RE-ENTRY
61
because of their proper velocities, are forever adjusting their clocks to the
local standard, and the calculation of arrival and departure times is a not
unsubtle art. But the black hole Stations themselves--which should distort time
as they distort space, spacetime being a seamless manifold--add no complications
whatever. This was an amazing and inexplicable phenomenon to the earliest
explorers ...
"... Walker found it convenient to posit a region of super-space where time runs
backwards. Walker, of course, had no reason to suppose he was describing
reality--he simply needed a term to make his equations balance. In the arbitrary
Walkerian scheme a ship approaching a black hole supposedly sets up a potential
time differential, a delta tan in super-space. This potential is discharged as
the ship leaps the hyperfold and re-enters the ordinary universe. Delta tau plus
should match delta tau minus. And it appears to. But does it really..,?
"... consider antimatter. For every kind of particle there is a corresponding
antiparticle. Yet the ordinary world is constructed almost entirely of ordinary
matter. In nature, antimatter is found only in rare deposits, locked in the
quark structure of the superhydrogens, as in the 'super-ice' glaciers of
Brindle. But why should not antimatter exist in the same proportions as ordinary
matter throughout the universe? Why are there no antiplanets, antistars,
antigalaxies? Physicists have long been accustomed to treating antiparticles in
two different but equivalent ways--as particles with reversed charge or spin or
magnetic moment relative to their ordinary particle mate, or as the ordinary
particle itself traveling back-ways in time....
"... do whole anti-universes exist, segregated from us by a time sense opposed
to our own, unable to communicate because their messages arrive before they are
sent, coded in mirror gibberish on receding waves? Do drowsy MaxwelFs demons
guard the black hole gates between these universes and our own, assigned to keep
everything separate but nodding off now and then and allowing the reversed
particles to slip through ...?
**... count the points on a line: an infinity. Count the points on a plane: a
greater infinity. Count the points in a three-space: a greater tnfinity still.
Now count the lines in a plane, the planes in a three-space, the three-spaces in
super-space..*
62
RE-ENTRY
"... maintain symmetry. Assume as many time-reversed universes as time-normal
universes. The number of each is infinite.,.
".,. assume the origin of aU universes in a Big Bounce. Assume the end of all
universes in a Big Bounce. Mark each Bounce on an abscissa, and connect them
with a smooth curve--above the line, time-normal universes, below the line, time-
reversed. Now recall that a sine wave graphs a closed curve
"... consider our presumption of instantaneous travel a shared illusion. One
never emerges in the same spacetime one leaves--hence those tiny shifts in the
phenomenal world we travelers of the universe have come to know so well. Are the
freckles on your lover's nose slightly askew since last you said goodbye? There
are a million billion yous, an infinity of yous, and you have a million billion
lovers. What orgies of rediscovery all travelers might enjoy, if only they knew
..."
Claymore switched off the fileslab she held in her hand, "Your voice?"
"We knew thai you--or someone like you--would find us sooner or later, Officer.
We're not professional conspirators." The woman was small, trim, spare; her
salt-and-pepper hair was cut close to her head. The only light in Unwin's office
came from a single desk lamp aimed down at the papers on his desk. Claymore
could not determine the woman's age, for she kept her face in shadow.
"The fake ident on this slab is hardy the work of an amateur," Claymore said
coolly.
"We are not amateur programmers," the woman replied. "But, unfortunately for us,
that bit of fakery was a woefully inadequate afterthought--when we realized it
was already too late to erase the memo to Phil."
Unwin stood dejectedly in the corner near the door, looking crumpled, as if he'd
been discarded there. "We had absolutely no idea Phil was going to use that..."
Claymore's look silenced him. "I find, Professor, that you give me more useful
information when I ask you direct questions."
"Aah, mmm," Unwin agreed.
His office was little more than a cubbyhole on the thirty-second floor of
Parnassus, its modesty reflecting the secondary importance to the Medical School
of its mathematics depart-
RE-ENTRY
63
ment. It was an outside room, though, with a view east across the floating
suburbs--flickering dull yellow lights in the smoky darkness--to the tall glowing
soleris in the hills on the far shore. On the otherwise dark flatlands of both
shores bonfires burned, kindled from trash and old planks ripped from the sides
of undefended houses.
"Amateurs or not, you have conspired to conceal evidence of a felony. And
perhaps worse."
"We're eager to have you understand what Phil was doing," the woman said. "Then
you'll know the theft of that lauder was his only crime."
"Everyone I've met is dedicated to apologizing for poor Philip Holder." Claymore
allowed her temper to show. "Unwin here has apologized for him at length. Holder
only wanted to atone for his skis, is that it, Unwin?"
"Mmm, aah.. ."
"I'm not referring to his motives," the woman said, with a touch of asperity.
"I'm speaking of methods. I'm talking about the laws of the physical world. Once
you understand those, you'll understand that Holder represents no further threat
to anyone in this universe."
"You too want to claim he's dead?"
"Not at all, though he probably is. YouVe studied our memo. You've studied the
abstracts it contains, all the way back to Walker and Wheeler and Hoyle. You
know that if Phil succeeded in traveling back in time, he's in another universe
entirely, one that has no causal connction with our own."
"A mathematical convenience, not a fact," said Claymore. "By that reasoning, we
should change universes every time we pass through black hole Stations, whether
we're attempting to time-travel or not."
The small woman in the shadows said nothing. Meanwhile Unwin nervously murmured
something inaudible.
"Well?" said Claymore, exasperated. "That's absurd, isn't it? The laws of cause
and effect demonstrably operate between here and Darwin. They operate now, and
they operated in the past, and they always will."
"Have you ever actually traveled to another star, Officer?" the woman asked.
"Relatively few people have."
"I made a trip to Brindle once," Claymore replied. (That had been lovely--so much
emptiness. But her work was on Earth.)
64
RE-ENTRY
"Since you returned from Brindle," asked the woman, "have you looked at any
pictures of yourself made before you left?" Her face came into the dim yellow
reflected light of the desk lamp; it was an old face, remarkably old for Earth.
(... are the freckles on your lover's nose slightly askew since last you said
goodbye...?)
A frisson of horror prickled Claymore's arms. "You're saying the Earth I'm
standing on now, here in this room, is not the same Earth I left?"
"The mathematical expressions we are discussing require that Officer Claymore's
Doppelganger left this Earth at the same moment Officer Claymore herself--you--
left whatever Earth you came from. A complicated hypothesis, but it suggests
some simple tests. For example, look at an old holo of yourself, and then in the
mirror. It's quite possible that random quantum events at the cellular level
have produced tiny changes in your appearance that only you would recognize."
For a moment Claymore chose not to doubt the outcome of such an experiment.
"Which of us would be real?" she asked quietly.
"You are real, of course. Could.I persuade you otherwise? Unwin over there is
real, I'm real--reality is experience. Just as proper time is the time where you
are, so proper reality is the reality where you are." The woman paused a moment,
and then added, as if it were an afterthought, "Of course all the Doppelgangers
are real too."
(A million billion yous, an infinity of yous...) The thought dizzied Claymore;
she pushed it away, changing the subject. "I want to leave the mathematics
'aside a moment..."
"You can't leave the mathematics aside," said the woman. Claymore persisted.
"... long enough to hear about the mechanics.*'
The woman sighed impatiently, then said rapidly, "We knew the precise velocity
of Humboldt at superspace insertion, barring accident; we knew the precise mass
of the stolen lander; we knew a number of other parameters. The problem was how
to delay the lender's passage through the hyperfold-- and how long to delay it
The longer the transition, the greater the value of tau minus. Humboldt emerged
in the so-called present The lander, staying in the fold the merest
RE-ENTRY    65
fraction of a second longer, emerged thirty years earlier." Claymore was silent
a moment, staring out the window at the smoky night. At last she said, "You'll
do the same for me.1* "We'll be glad to show you the calculations we did." "No!
New calculations. Based on a new Darwin transit. Fll be able to give you the
details by morning. The ship will be Sprint class; we'll equip it however you
recommend.'* "But whatever for?" Unwin protested. "I intend to pursue Holder and
eliminate the threat he represents," Claymore told him.
"He represents no threat whatsoever!" Unwin sounded genuinely shocked.
"He can change the course of history.'* "Some other history, perhaps. This
reality is already what it is."
"Whether he means to or not" Claymore finished. The old woman intervened.
"Officer Claymore, experience suggests that when a mathematical construct
accurately predicts events in the real world, it is to some degree "true.* Our
construct posits the generation of all possible universes simultaneously, not as
a uniquely determined outcome, but as a set of probabilities--like a wave packet,
a wave of waves. Our wave packet can be treated as a single entity, a "slice of
life,' *relaton,f if you will--but only by experiencing its precise properties
directly at any given moment We all constantly sample reality, and in the act of
sampling, determine what is real for us in our universe.**
"And we know damned well Phil Holder didn't do what he said he was going to in
this reality," said Unwin huffily. "I'd have known about it, directly. And
another thing--if you go after him, how are you going to manage to end up ur*the
same place he did? There are a million billion alternatives, remember? An
infinity of alternatives."
"Which 'he,' Unwin?" Claymore asked, acidly. "'By your model there are an
infinity of Holders, too. Even if some of them succeeded in altering some
realities, we could hear about it from the very next ship that comes back
through Earth Station."
"Impossible!" Unwin was almost shouting now, pushing his bulk forward into the
dark cramped space to confront Claymore. "You have not grasped the nature of the
directional bias that..."
"Of course the possibility is vanishingly small*" the old
66
RE-ENTRY
woman mused, interrupting Unwin as if he had not spoken.
Unwin froze, open-mouthed. "What are you saying, Clarissa?*' He struggled to
regain his composure. "It was you who argued that significant changes can
accumulate only in neighboring.. .**
"Nevertheless..." the woman began.
But Unwin, betrayed, would not listen; he turned on Claymore, his dignity
restored by anger. "Follow Holder if you wish, Officer. But let me warn you, it
takes a suicide to make the attempt. We know for a fact that most of those
infinite Holders didn't succeed--the man who might have landed in our past, for
one. Holder knew the odds too. If you follow him youll share those odds. You'll
end up where he did. I happen to think that's nowhere, and I do mean Nowhere."
**Your accent has disappeared, Professor," Claymore said.
Unwin smiled, but he looked ghastly. "Some of your Doppelgangers will doubtless
get through. Is that any comfort?"
"Will it comfort you, Professor? You realize I need to be reassured as to the
accuracy of your calculations; and so, of course, you must come with me, you and
Professor Sirich."
72
"Her critics to the contrary, Tanaka was always acutely aware of the seeming
paradox of Darwin: that of an institution dedicated to the study of adaptive
change, which pursued those studies by attempt-nig to recreate and preserve a
collection of separated, static environments.
"But Tanaka always maintained that it was best to try to understand one thing at
a time. First, she said, we must learn the construction of the individual
organisms themselves. Second, through a kind of vital mimesis we must learn to
construct complex stable ecosystems typical of those which existed at
RE-ENTRY    67
various times in the history of Earth--a process that could well require
centuries. Only then could we hope to control the complex variables of ecosystem
change.
*'Not surprisingly, Tanaka took a leading role in shaping the Uniform Code of
Natural Human Life, the major thrust of which was to halt tendencies toward
uncontrolled artificial evolution of the human organism. At the time only a very
few people knew that Tanaka herself was in heinous violation of several of the
Code's most basic tenets, including those against direct intervention with the
underlying metabolic processes and those against permanent alteration of the
reproductive organs.
"Elizabeth Tanaka lived to the ripe old age of eighty-five years (Standard)
before arranging to have herself expire. We may note in passing that the woman
born Margaret Tanner subsequently appeared under four different guises during
the course of the next century (see Notes in Appendix m for biographical
details) before assuming the identity by which, as fate would have it, she
became known to posterity--that of Clarissa Sirich...."
(from Darwin: A Millennium of Conservation)
On Earth they had begun saving genetic samples in the last quarter of the 20th
century, when the imminent collapse of genetic diversity had become clearly
apparent The wild strains were preserved as a hedge against the miscarriage of
man's laboratory wonders. Optimists thought they would be useful to maintain
arboretums and zoos; only pessimists thought they would ever be needed for any
serious purpose.
Thus the pioneers of Darwin had a relatively easy time, several centuries later,
reconstructing the plains of East Africa, the tundra of North America, or the
Australian desert ca. 1850 O.E.
The latter epochs of the Tertiary period provided an interesting challenge,
though in many cases refined Amosov-Cole techniques could be used on actual
frozen or mummified tissue samples.
The Mesozoic era was much more challenging, for there were very few organic
remains to be imported from Earth: a few insects in amber, an occasional carbon
"copy" left
68
RE-ENTRY
when an animal had disappeared leaving behind only its cellular carbon, or here
and there perhaps a bit of much-altered bone. Most of what survived was stone
analogue-- skeletons, fossilized skin, die imprint of scales or feathers,
petrified footprints. Animals from before the Cenozoic had to be recreated from
scratch.
Knowing approximate age and evolutionary lineage, a genetic engineer could
specify the proteins presumed to constitute the animal, and the exact sequence
of then- amino acids. Known proteins were synonymous with known genes; known
constellations of protein implied known control genes.
But the "one gene, one protein" approach had gone out of fashion a couple of
decades after the elucidation of die structure of DNA--it was over-simplified and
inadequate to explain (among other things) morphology. The shapes of closely
related animals often differ far more than then* protein sequences would
suggest, and animals that look very much alike often have widely divergent
structural genes.
Picture a sequence of animal skeletons--different, but related through
evolutionary time--as frames of an animated film. When projected, the film would
show bones stretching, contracting, growing thick or thin, appearing here and
expanding, contracting there and disappearing--with continuity evident throughout
That the forms of related plants and animals change over time, that species are
extinguished and new species arise while the basic continuity of life goes on,
was evident to several thinkers before Charles Darwin. So plastic did life
appear that most pre-Darwinian evolutionists thought the evolutionary mechanism
must be simple, and fairly fast-acting--perhaps animals could change shape merely
by taking thoughtl
Plastic dinosaurs are plastic only from the god-like perspective that squeezes
tens of millions of years of evolution into a few seconds. But such is the
perspective of an ordinary Genetic Engineer Grade 18 (specialty: ornitbischia/
saurischia). Already equipped with a catalogue of protein-and protein-control
genes, his tool kit was made complete by a sophisticated set of so-called
morphogens unknown to earlier ages. The morphogens were not mysterious
substances in themselves; rather they were complicated assemblies of known
hormones and other simple chemicals whose function was controlled by even more
complex genetic timing sequences. Yet once these timing sequences had been
mastered,-
RE-ENTRY
69
basic animal structures could be shaped to any final form the engineer desired.
Take the standard vertebrate forelimb--it could be shaped in (vitrous) utero into
a bat's or a bird's wing, a dolphin's flipper or a frog's webbed forefoot, a
bear's daw or a monkey's hand or a horse's hoof. Indeed, the engineer could grow
human hands on a chicken, or wings on a woman. None ever tried it, on Darwin--the
penalty for deliberately creating a monster was exile.
Several decades passed while Darwin's genetic engineers mastered morphogenic
techniques. Meanwhile planetary engineers'1 completed a task that was
conceptually simpler, but staggering in practice--the sterile isolation of one
geological age (the reserved continent or sub-continent) from all others. For
big land animals, wide bodies of water and high mountain walls were enough. But
to keep flying and swimming and climbing and drifting things apart, impenetrable
barriers, as deep as oceans and as high as the sky were needed. These barriers
were created from diverse materials according to need: here currents of warm or
cold air and water, there impermeable glass dams; here permanent flows of molten
lava, there permanent chains of electrical storms; here a simple electrical
fence, there beams of deadly radiation or poison gas or acid rain. Over ninety-
nine percent of its surface, Darwin was the Garden of Eden; here and there it
was hell.
At last all was ready. The institute for Biological Research was dedicated in
the planetary capital of Cuvier, and the wandering visitor could find
inscriptions here and there, carved into odd niches of the polysteel stonework,
suitable to the work going on inside. One read:
The biologist is in the position of an archaeologist who uncovers a machine
without any written record and attempts to reconstruct not only its operation
but also its purpose.
--Richard C. Lewontin, l!?78 O.E.
Immediately below was the bold postscript:
Often it is necessary to reconstruct the machine first.
--Elizabeth Tanaka, 11 N.E.
70
RE-ENTRY
RE-ENTRY
71
But inside the Institute, where no casual visitor was likely to see them or
comprehend them if he did, a great many other inscriptions were written, using a
different typeface, a more restricted alphabet, and an altogether different
language--for example, these instructions for the assembly of Tyrannosauria rex;
GGAAAGCGGGCAGTCAGCGCAACGCAATTAATGTGAGTTAGCTC
CCTTTCGCCCGTCAGTCGCGTTGCGTTAATTACACTCAATCGAQ
ACTCATTAGGCACCCCAGCCTTTACACTTTATGCTTCCCGCTCQ
TGAGTAATCCGTGGGGTCGGAAATGTGAAATACGAAGGGCGAGC
TATGTTGTGTGGTTAATTGTGAGCGGGATAACAATTTCACACAQ
ATACAACACACCAATTAACACTCACCCTATTGTTAAAGTGTGTC
GAAACA CTTTGT...
(and so forth, for roughly a million pages.)
73
"You're sure I don't know you, Unwin?" the Chief Ranger demanded, squinting
hard. "You look damned familiar." The rays of the setting sun shone fully on
Alex Holder's dark, smooth-shaven face.
Philip Holder choked back the irrational panic knocking at his throat. Alex
Holder was an impressive man, impressive enough to scare hell out of his son,
even though he was much shorter than Philip Holder remembered him--and even
though the son was now eight years older than his "old man." But his father
could not possibly imagine the truth, "I'm sure we've never met. I must have one
of those faces."
"Must have. You look a lot older than I thought you would, too. What's a man
your age doing at loose ends?" The Chief Ranger took a deep swallow of his rye,
keeping an eye on Holder over the rim of his glass.
"I was on sabbatical, Ranger, from the Math Department at Epseridan U. And
frankly, I fell in love with my freedom.
I decided to see a little more of the universe before I locked myself up in a
classroom again. Before I knew it, I found myself, aah, embarrassed for funds."
(A bowdlerized version of Unwin's real adventures, thought Holder, but Dad
bought it-- that other time.)
"I sound brusque, Unwin?" The Ranger's expression soft-tened somewhat. "Sorry.
Been spending too much time back hi the bush." He held up his empty glass and
rattled the ice cubes. "Have another?"
"Don't mind if I do," Holder said huskily.
"You too, Frank," Alex said to the sinewy, sun-blackened man, also in Ranger's
uniform, who sat with them at the outdoor table. "On the company." Without
waiting for the man's reply the Chief Ranger waved three spatulate fingers
toward Waterhouse's innkeeper, who'd been keeping the Holder party in view while
serving the other guests on the observation deck.
Cobb, the innkeeper, nodded in Alex's direction. There were no helots on Darwin,
and most Darwinians were proud and independent, even those who dealt
professionally with tourists all the time. Alex Holder got a touch of extra
service nonetheless, since Waterhouse operated at his sufferance. Off-worlders
were permitted this far up the river but no further, except in small, closely
supervised tour groups--lest they be crushed or eaten by dinosaurs, or worse,
somehow upset the delicate experimental ecology of Upper Cretacia,
For a moment the three men were silent, watching the evening unfold. The low sun
backlit the shapes of huge reptiles gliding across the metallic sheen of the
swamp. Palms and hardwoods stood up orange and black against the purple sunset
sky. Far off, over the treetops, pteranodons wheeled. The scene was almost too
vivid, like a set for a musical sensie.
The reptilian swimmers were a family of titanosaurs (big, but smaller than their
name suggested), who poled then-bodies across the shallow swamp by reaching
their forelegs down to the bottom mud. They held their heads high and let their
hind legs and tails float along behind them.
The taciturn Seaton broke the silence. "Big female in the middle's the same one
got away from that three-year-old rex last monsoon. You recall, Alex? She drew
him into quicksand."
The Ranger snorted. "Do I recall? Mamaka told me we almost lost the copter,
pulling him out."
72    RE-ENTRY
Seaton nodded. "Yes, that's her. See the scars above the shoulder? Teeth. She
was lucky."
The innkeeper appeared with the drinks and set them on the plank table.
'Thanks, Mr. Cobb," said the Ranger.
"My pleasure, Alex," said the big affable innkeeper. "By the way, I've reserved
the Iguanodon for you and your party, if you're interested."
Alex laughed. "Why not? Unwin here will get a kick out of it."
Phil Holder pretended to be puzzled.
With a broad smile wrinkling his square face, Cobb explained. "Our establishment
takes its name from the very first man who ever had a go at restoring dinosaurs,
Mr. Unwin. His name was Waterhouse Hawkins, and he lived in England back in
O.E., in the 19th century. In those days the iguanodon was about the only
complete skeleton they'd found, and Hawkins made some life-sized models of the
beast for the Crystal Palace exhibition."
"Pretty good models, too," Alex Holder put in, "considering. Course they didn't
look a thing like an iguanodon."
"The people who'd sponsored the reconstruction were so proud they all got
together for a fancy dinner to celebrate the event--and the dinner was served to
them inside one of the models," said Cobb with relish. "The guests included some
of the most renowned gentlemen of Victorian natural philosophy. Including
Professor Owen, after whom we've named the mountain."
"Charles Darwin too?" Holder asked, though he knew better.
"Oh no. This was years before the Origin, and Darwin and Owen became bitter
enemies anyway. Very ironic in retrospect, but Owen, who coined the word
dinosaur, would have absolutely nothing to do with the notion of evolution. He
did his best to sink Darwin."
"But what about your iguanodon?" Alex prompted,
"Oh yes," said Cobb. "Well, we've reconstructed Mr. Hawkins's model and set it
aside as a sort of private dining room. It seats three or four people quite
comfortably. How they ever got twenty or more in their model, I'll never know."
Holder grinned his appreciation. "I look forward to the experience, Mr. Cobb."
Cobb nodded, pleased that the Chief Ranger had given him
RE-ENTRY
73
the opportunity to trot out this well-polished anecdote. "Very " nice to meet
you, Mr. Unwin. See you gentlemen later this evening." He walked away.
Alex turned back to Frank Seaton, looking at him thoughtfully. He knew, as did
Philip Holder, that Seaton didn't make casual remarks. He'd brought up the
episode of the rescued tyrannosaur for a reason.
Holder still clearly recalled one of Seaton's finer moments, when the wiry black
little man had been cursing and spitting and holding on to the tail of a
peckerish juvenile rex for dear life, as he wrestled it back into the stockades
away from the tops pens. One whiff of rex could turn a placid triceratops cow
into a 8,000-kilogram battering ram that no fence could restrain. Seaton wasnt
so much bothered by the struggle the little dickens was putting up (after all,
it was hardly more than a baby, not even two meters long); it was the foul-
smelling tyrannosaur shit he was getting all over his new high-heeled boots and
twill trousers.
Holder treasured his memories of Seaton, who had taught him never to fear
animals, but to treat them with, precisely the respect they deserved. Cowardice
and courage were inconsequential concepts in Seaton's view of the world;
informed action was everything.
"Frank, we're wasting too much time and energy pulling gorgos and rexes out of
the swamp these days. Animals that should be surviving on their own," said Alex.
"Might think about higher ground," said Seaton.
"Okay, I'm thinking."
**A rex's just like any other carnivore, Alex--just plays the odds. Rather eat
fresh dead meat than alive. Failing that, rather catch 'em old or sick. I've
seen a few rexes in hot pursuit go after prey in deep water, but they won't do
that if they have a choice."
*They do a lot better down south of the river," Alex said. "Away from the
tourists. They might do better yet inland,"
"Might," Seaton agreed. He'd made his point
Alex looked at Holder. "Sorry to bore you with all this shop talk, Mr. Unwin."
"Oh, that's fine with me," said Holder. "I'm fascinated." And he was; he'd never
been included in these discussions when he'd been a boy.
"Sure," Alex grunted. "Hope you still think so a year from now. You and I got
anything left to settle?"
74
RE-ENTRY
RE-ENTRY
75
Holder spoke cautiously. "You're offering me the job?" "Already did. You're
qualified, and I like your looks--a lot better than I thought I would, to tell
the truth. I think the salary's fair, so now I'd say it's up to you. Can you
take a couple of years hi the wilderness surrounded by primitive brutes--such as
me and Seaton here?"
Holder laughed. "I believe the answer is yes, Ranger." "Alex. Here's to you,
Telly-whatever. How the hell do you pronounce that? Now you work for me I can't
go around calling you by your last name all the time."
"Just call me T.T. It's simpler." Holder raised bis glass. "To you, Alex. And
you, Frank."
"To a bright future, T.T." said Alex.
Holder's future as T.T. almost ended abruptly.
The three men set off early the next morning for the wharf, descending
Waterhouse's main staircase to ground level and letting themselves through the
electrified steel gate, Alex's limp was pronounced this early hi the day, though
he would lose it as he wanned up. Despite his wife's urgings, he'd never had his
leg properly regenerated after bis brush with a gorgo some years earlier. Holder
suspected he was proud of the
stigma.
The morning was fragrant with the perfume of magnolias, softened by the calls of
primitive water birds. In the ponds the sauropods browsed. To Holder they were a
familiar and comforting sight, a sign of home. He had grown up with dinosaurs as
few others had, and hi fact was more comfortable around them than his father
was. Dinosaurs had been Philip Holder's pets, beasts of burden, and occasionally
the brute adversaries against which he'd pitted his emerging manhood.
Waterhouse was built well above ground--a tyrannosaur could just stand erect
beneath the floor of the elevated buildings. In an effort to create a sense of
wild country the kilometer-long path from the dock was at ground level, carried
on wooden causeways over the surface of the ponds for most of the distance. With
nothing between the walkway and the water but a wooden handrail, the naive
tourist got a thrilling (in fact, somewhat frightening) sense of exposure, for
semi-aquatic sauropods, wholly peaceable creatures, often waded within touching
distance.
Here and there the path crossed potentially dangerous firm ground. If a tourist
were to find himself trapped in a muling
herd of hadrosaurs he might soon be trampled all innocently into the gooey mud.
Herbivorous dinosaurs had no fear of humans, nor any real consciousness of
humans at all, and would step on a man as casually as on a beetle. Therefore
over dry land the path was lined with barrier fences, picturesquely overgrown
with lianas and flowering creepers, but constructed of polysteel posts sunk in
concrete.
The men were halfway to the river on a stretch of path bordered by the tall
barriers when an enormous adult rex stepped right through the fence in front of
them. It was not chasing anything. Apparently it had merely blundered into the
fence, by chance stumbling into a section whose foundations had been invisibly
undermined. The rex blinked its red eyes. Only a moment passed before the giant
reptile realized its good fortune.
"The water, Frank!" Alex bellowed. He was several steps in front of the others,
nearest the animal. He turned to run.
The tyrannosaur took one tentative step. Then another. And suddenly the ground
trembled under the beast's awesome charge. A deep and horrifying roar blasted
from its throat.
The protective fence now prevented escape. It was twenty meters back along the
path to the nearest open water. Momentarily Alex considered the fence itself--
easy enough to climb if there were time, but he would be nowhere near the top
before the rex was on him.
Frank Seaton was already running away as fast as his legs would carry him,
screaming at the top of bis lungs and waving his arms wildly. His behavior was a
parody of stark terror, a calculated attempt to draw the animal's attention.
The Chief Ranger stood immobile. He had not panicked; there was simply nothing
to be done. He could not climb fast enough, and even with two perfectly good
legs he could not have outrun a tyrannosaur. He turted to face the beast,
determined to look his death hi the eye.
Tyrannosaurus rex presents two major problems to an adversary, one at each end:
a mouthful of grisly teeth and a skull-cracking tail. Its tiny forelegs are so
short they are useless in an argument, and the beast is so ponderous that,
unlike its much smaller and more agile predecessor Deinonychus ("terrible
claw"), it cannot stand on one hind leg while slashing out with the other. The
safest place to be in the immediate vicinity of a hungry rex is underneath it
76
RE-ENTRY
RE-ENTRY
77
The creature's jaws were wide and already swooping down when Holder hit the
Chief Ranger from behind and took him to earth in a flying tackle. The blow was
so strong that the men fell in a heap together, Holder on top.
The rex had a choice: it could back up a step and look for the morsels that had
but lately been right before it, or it could go after Seaton, who was hi plain
view and behaving the way ordinary carnosaur prey should behave.
The two Holders lay panting on the ground beneath twin columns of muscle and
bone and gristle that supported the monster's improbable bulk, waiting for its
tiny brain to grind out a decision. The three-toed, meter-wide claw beside them
lifted from the mud....
A rex always plays the odds, Seaton had said, and so it was: the dinosaur took
off in pursuit of Frank Seaton. Since a running theropod carries its tail high,
the Holders escaped unscathed.
Phil Holder scrambled to his feet and gave his father a hand up. They ducked
through the gap the rex had made in the fence. Seaton had already made good his
escape, diving into the water several meters ahead of the rex.
"Hope that animal doesn't follow him in-," the Ranger gasped. "We'll have the
devil's own time getting it out."
"People are coming from the hotel," Holder said.
"Curare guns. Knock him out. Nothing short of a rocket will kill him, and when
they see we're safe they won't do that."
They heard splashing in the water, and saw Frank Seaton swim toward them and
drag himself out onto the muddy shore. He was breathing hard. He turned to watch
the action behind them, toward the hotel.
They could all see the rex's head above the fence, searching in frustration.
They saw men and women from the hotel pounding across the wooden bridge toward
the dinosaur. The tyrannosaur roared defiance and stood its ground. A man raised
a heavy rifle to his shoulder and fired. The tyrannosaur screamed and suddenly
sat down out of sight behind the fence. The barrier sagged with its weight
"Good shot!" said Alex with satisfaction. "Didnt topple him over and break his
damn fool neck."
Only then did Holder reflect how the real T.T. Unwin would have behaved in this
spot. The authentic Unwin had once distinguished himself by running in terror
from the camp's mascot, a toothless egg-stealer that had approached
him for a handout. The mooching oviraptor was the same size as a plucked turkey,
and looked rather like one.
Holder put the thought out of his mind. This was a different world, and he hoped
to make it even more different yet.
Holder noticed that the dripping-wet Seaton's attention had shifted from the
dinosaur to him. He swallowed. "Lucky, weren't we?"
Seaton said nothing. Holder knew Frank Seaton didn't believe in luck.
14
Claymore sent helot guards for Unwin, but she went after Sirich herself.
"I've never been kidnapped so politely," said Sirich. "I don't suppose you would
allow me to contact an attorney? I'll be sure to make a point of your good
manners.**
Claymore smiled and shook her head.
"Well, consider this an official protest, then." The old woman's face crinkled
in amusement. "Though to tell the truth, Tm rather enjoying the change of pace."
Since the previous day when Bicknell at Security Headquarters had confirmed that
Claymore would be assigned a Sprint, Unwin and Sirich had worked full time
deriving the transfer values. Strangely, Sirich and Claymore had conceived a
liking for each other within that brief time span. At first Claymore thought it
was routine, one-way, induced trust, which Claymore had used on both Sirich and
Unwin for simple insurance. While that might account for Sirich's friendliness,
it would not account for Claymore's liking of Sirich--who had induced what in
whom?
Moving stairs sped them toward the roof. They left behind thousands of people
moving quietly along the softly lit vine-draped tiers of the building's vast
internal cavity, people on the way to home or work or wherever their errands
took them during the soleri's never ending cycle of activity. Claymore
78
RE-ENTRY
and Sirich observed the convention of silence until the escalator carried them
past the top stratum of the mountainous structure. Then Claymore said, "Do you
see why I won't believe the horrible odds you and Unwin are projecting?"
"I think the next few days will be interesting, Angelica, but I also suspect
they will be my last," Sirich replied soberly. "I'm a very old woman. The
prospect of death neither entices nor terrifies me."
They came to the traffic control barrier. An armed helot guard watched from the
sentry post, impassive and immobile. Claymore held her thumb against the sensor
plate. "Claymore," she told the guard. "Accompanied by Clarissa Sirich.
Authorized." The barrier slid away and both women passed through.
Through the curve of the glass roof they could see Claymore's airplane on the
pad a few meters away, waiting to take them into the low orbit where the Sprint
was parked. The plane's black skin reflected dull red rhythmic flashes from the
soleri's overhead aircraft warning beacons. The launch deck was narrow; beyond
the edge of the finger-like concrete projection was a hazy night sky and nothing
else.
"Unwin's behind schedule," said Claymore. "The security here is lax."
"One of San Francisco's traditional attractions," Sirich remarked.
"We'll wait here a moment." Claymore looked at Sirich curiously. "If you and
Unwin are so pessimistic, why did you cooperate with Philip Holder?"
"You're a perceptive woman. Surely it's plain to you-- Unwin's jocund exterior
notwithstanding--that he hates Holder's memory?"
The thought had not occurred to Claymore.
"I'm sure that's why he cheerfully assisted in what he was certain would be
Holder's doom," Sirich continued. "Even to providing him with old moneyslivers
and other bits of identification, and helpful hints on what to do when he
arrived on Darwin. I wouldn't be surprised if some of that information was
deliberately phony--just hi case Phil did get through."
"Unwin does seem to want to hedge his bets. And you, Clarissa? Why did you help
Holder? Didn't you share Uriwin's hopes for the outcome?"
"I'm an old spinster--perhaps I let Phil's handsome charm
RE-ENTRY
79
carry me away." Sirich grinned impishly. "That's Unwin's interpretation. But the
truth is, at first I thought I was just helping him pursue an intellectual
curiosity. Later he convinced me he knew what he was doing, and had every right
to do it. Conversely, I had no right to stand in his way."
**Even if you thought he'd kill himself?" Claymore's voice conveyed the inborn
fear and disgust of any native of Earth for any instance of avoidable,
irreversible death,
"The same probabilities that dictated death for most Phil Holders, most of his
Doppelgangers, assured me that some at least would survive. An extraordinary
moral dilemma," Sirich said as an afterthought, as if commenting on a
particularly challenging math problem.
Now they spotted Unwin arriving at the top of the last escalator, far off among
the shadows under the domed roof. He was closely escorted by gray-uniformed
helots, one at each elbow. His step was heavy and slow.
The two women watched a moment in silence. Then Claymore said, "You claim that
most of the Philip Holders did die,.." She shuddered. "I don't know what I'm
saying when I say that. It sounds preposterous."
"Yes, I'm sure most Phil Holders did die, Angelica. So will most of us--most
yous, most mes, most Unwins. Painlessly, of course."
**What of the other obvious interpretation, Clarissa? That there's no record of
Holder's success because we have already prevented it."
"Have it your way." Sirich shrugged. "Unwin and I are giving you the best
calculations we can, to help you follow Phil. Still, I think our chances of
personal survival, in the words of the old saying, are those of a snowflake in
hell."
Unwin and his escorts approached the barrier. Through the clear barrier Claymore
could see that Unwin was extremely agitated. His face was flushed, and he would
not look at either woman.
"He's going to need sedation," said Claymore, annoyed. For a moment she wondered
if Sirich and Unwin weren't mounting some elaborate charade. She didn't want to
believe it of Sirich, but she wasn't sure she could trust her own feelings.
An instant later the question was tabled. As the barrier parted in front of
Unwin, he took advantage of a moment's freedom to bolt for the doors that opened
onto the landing pad.
80
RE-ENTRY
The guards and the sentry fumbled for their sidearms simultaneously, like
synchronized automata.
"No!" Claymore ordered. "Leave this to me!"
Two of the helots obeyed her immediately, standing aside, but the third, one of
Unwin's escorts, paid-no attention to her, apparently confused. He raised his
weapon and took aim.
As Claymore moved for the guard she noticed something odd from the corner of her
eye: Unwin had paused well within range, frozen in anticipation of the helot's
next move.
A firegun is a terrifying psychological weapon, but rarely lethal unless the
victim invites it Claymore brushed the helot's hand aside just as he squeezed
off a bolt. The blob of fire blackened the glass beside Unwin's head. By now
Claymore had the guard's hand between her thumb and fingers.
The weapon clattered to the floor. The man's face twisted in reflexive pain and
he turned toward her, wildly swinging his other hand. She stepped aside, planted
her feet well apart, and with a graceful flowing downward motion of her arm and
shoulder assisted the helot into a spectacular somersault; he landed in a heap
two meters away.
Clearly someone had been tampering with the helot
By the time Claymore's attention was once more focused on Unwin the stout old
man had turned and begun to run, throwing aside the outer doors and dashing onto
the landing pad. Claymore hesitated. If he were headed for the plane she would
have to draw her own weapon and drop him before he could
damage it
But he ran past it, right to the edge of the pad. And he ran over the edge
without hesitation...
He would not stop falling for half a thousand meters. The velocity with which he
struck the ground would be only somewhat moderated by wind resistance.
Claymore stared after him in horror. Trembling, she turned to Sirich, who stood
bright-eyed and alert beside the barrier. "What was that?" Claymore demanded
hoarsely. "Are you all in some mad league of suicides?"
The old woman's voice was sharp. "Welcome to the club."
The buzzing airboat skidded around 'a bend in the broad river. Ahead lay the
Administrative Headquarters for Upper and Lower Cretacia, less formally known as
Camp Owen Gorge.
The Camp was a tiny place, even allowing for Holder's exaggerated childhood
memories. In all Cretacia, half a Darwinian continent there were no more than
ten thousand legal residents, most of them living in Copeville, where they were
directly engaged in the tourist trade. Cretacia belonged to the dinosaurs.
From the Camp broad lawns descended to the river. The Chief Ranger's quarters
stood at the top of a grassy rise under big old shade trees, the largest of a
series of connected dormitories and staff apartments, low earth-colored
buildings with roofs of dark red tile. Hidden behind the living quarters, Holder
knew, were laboratories extending several hectares back into the jungle. Though
not the great basic research establishment to be found at the Institute in
Cuvier, these practical field facilities could nevertheless make ad hoc repairs
to an organism, collect and record data, and, when necessary, grow a good-sized
animal from scratch.
Downriver were pens for animals not yet released into the wild, or temporarily
withdrawn from the struggle for existence. The immense saurian feedlot was
partially hidden behind thick stands of monkey puzzle, but its penetrating odor,
not unlike that of a pig farm, was undisguisable. Holder would have to get used
to it all over again.
Just upriver rose reddish-black cliffs lushly overgrown with ferns, the first of
a series of huge stairsteps building up to the smooth slopes of Owen. Here the
muddy waters of the Marsh descended in mighty cataracts over colossal piles of
basalt thrown down from the heights in the geologically recent past Beyond this
point no human could penetrate Cretacia except
81
82
RE-ENTRY

on the back of an animal or in an aircraft. The clattering roar of a huge
waterfall issued from the great fissure in the cliffs, as if from a megaphone.
"Noisy out here on the river," Ales shouted at Holder, "but once we get in the
shadow of the cliffs it's not that bad."
As he spoke the speeding boat passed into the shelter of the cliff. The roar
subsided. A cool spray of water soothed Holder's overloaded senses with a dank
perfume of mud and fish and algae.
"Couple of hundred years ago, at the time of the Reformation, there was a big
soleri across the mouth of this canyon," Alex said. "Produced hydro power,
housed maybe 20,000. Ripped it all out. Hardly recognize the ruins, now."
Frank Seaton expertly piloted the pontooned boat toward the docks, cutting
propeUor power at the last moment. A whiff of ozone and hot lubricant overtook
Holder as the boat slowed. The twin hulls settled deeply into the opaque green
water, and the boat drifted to a stop beside the wharf.
Seaton was quickly over the side onto the boards of the wharf, taking turns of
the painter around an iron cleat Holder clambered onto the dock and turned to
give Alex a hand with the bags, but Alex was already ashore. He handed Holder
his canvas satchel, and spoke to Seaton. "Thanks, Frank. Give me a report when
the copter crew gets back, will you? I want to know the rex is all right and the
fence is back together. I won't clear the Marsh Queen until I hear that** "Sure
thing, Alex."
"One more thing. Let's move fast on your idea of moving more theropods inland.
Starting with that big dumb one who attacked us. Will you plot the logistics on
that?"
"No problem, Alex." Seaton jumped back into the boat, securing its tackle.
"Meet with you tomorrow morning." Alex turned to Holder. "Let's go. I'll
introduce you to Phil and show you around."
They turned toward shore. A teen-aged boy had run down to the dock to meet them,
a skinny kid with huge feet and a big-eyed, oddly lopsided face. His skin, the
more or less standard human-colored skin of all the non-Earth worlds, was even
more darkly bronzed by constant exposure to tropical sunlight, and he had a
sprinkle of mahogany freckles across the bridge of his short nose. For just the
barest instant Holder wondered whose he was.
"Hi, Phil," said Alex. "Where's Mom?"
RE-ENTRY
83
The boy shrugged, adolescent sign language for "How should / know?"
Holder stared at him. Oddly, he felt nothing for the moment beyond intellectual
curiosity. No wonder the face looked lopsided: it was mirror reversed. Himself.
He hadn't recognized himself.
For his part young Phil seemed mildly curious about Holder, but too defiantly
shy to stare at him,
"Son, this is Mr. T.T. Unwin, the teacher we talked about" Alex smiled. "I'll
let him tell you what the Ts are for."
Phil glared at Holder then, but still he made no move.
"Shake hands like a man, Phil," his father said impatiently.
Phil lurched forward and held out a paw that was as enormous, proportionally, as
his feet. "Nice to meet you, Mr. Un-whV he muttered almost inaudibry*
"Call me T.T.," said Holder heartily. He took the boy's hand and his skin
prickled, his stomach fluttered. He forced himself to endure it The sensation
was distinctly odd, like nothing he'd experienced except for a few times when
he'd caught a whiff of a baby's milky breath--and when he'd tried to report the
strange queasiness of that experience to others, seeking confirmation, no one
had known what he was talking about; he'd hypothesized sensitivity to some
particular organic molecule and let it go at that
Phil pulled his hand away from Holder's.
"Good to meet you, Phil," said Holder hastily, realizing he'd been clinging to
the boy's hand overlong. "You're bigger than I expected." (Damn! What a stupid
thing to say--of all people, 7 should know how sensitive he is.)
"Fresh air's good for him," Alex said witfc satisfaction. "Phil, take T.T.'s
bag. We'll go up to the house and find the miz."
"I can handle it," said Holder as Phil reached for his overnight bag.
Phil gave him a reproachful look. His father had told him to take the bag; the
matter was not for argument Holder dropped it like a hot potato.
They set off across the lawn, Alex marching ahead, Phil hurrying to catch up to
his side, Holder bringing up the rear. He had not made an auspicious
introduction to himself,
"Did you fight a big rex, Dad?" Phil asked his father breath-iessly. "They said
on the radio..."
"Yeah, it was interesting for a minute. Actually T.T. here
84
RE-ENTRY
RE-ENTRY
85
saved the day." Alex laughed. "And he's never seen a dinosaur up close! Maybe he
didn't know enough to be scared, eh,
T T ?"
"It wasn't really..." Holder began, before he realized Phil was ignoring him.
"What'd you do, roll under him?" Phil asked his father.
"That's how we ended up."
"Yeah, that's just what I would have done," said Phil, boast-Ing wistfully.
Holder heard the aching love in the boy's voice as Phil attempted to identify
with his father's tribulations, heard it expressed as an assumed sophistication
about the ways of dinosaurs and Rangers. And Alex was sending signals just as
false, in attempting to downplay his danger. Holder was helpless to clear up the
miscommunication. The shadings of meaning were so delicate, and so delicately
misconstrued, that any attempt to clarify them would make them worse. Some
aspects of adolescence were going to have to run their course without his
interference.
Lost hi these reveries Holder almost collided with Alex, who had stopped bn the
porch of the big house. Phil went inside first, pushing the wide .wooden door
aside, shouting, "Mom? You in here? Dad's home."
Holder followed Alex into the cool dark house. He smelled a peculiar odor, a
pleasant odor, compounded of just what he was not sure. There was furniture
polish and dust in the drapes and a whiff of musty fungus, a woman's perfume and
a residual tobacco smell from Alex's occasional pipe, and some originally vile-
scented spray meant to keep all these other smells at bay (it had lost the
battle). It was the quintessential smell of home; no holo, no souvenir, not even
living, breathing people out of his past had convinced Holder so surely as this
faint aroma that he was really here.
He glanced to his left, into the darkened living room with its grey rugs, its
book-lined shelves, its tasteful scenic oils, its perhaps too overly refined
overstaffed chairs and couch. All was there, just where it should be.
He glanced back, eager to peer into the other rooms of the house. A woman was
standing in front of him.
(Be honest. She's not that beautiful...)
"Mr. Unwin? I'm Isabel Holder. I'm pleased to see you."
Isabel Holder was shorter than Alex, but seemed taller. To Holder she seemed
tall, cool, elegant--utterly inviting and
utterly unapproachable. Forced to be rational, he would have described her as a
well-bred, withdrawn, generally pleasant brunette woman of about thirty-five,
but at the moment he was incapable of any such clear-eyed description.
Already she had moved to place herself between "Unwin" and her son Phil.
Perfectly conscious that her husband had hired Unwin to take charge of her
child, she was prepared to dislike him intensely. Her resentment was not lost on
Holder. Presumably poor Unwin--the real Unwin--had experienced Ihe same hostility;
he'd had no choice but to stick it out, and neither did Holder. Holder felt
distinctly unwelcome hi what was after all his own family home.
"You'll want to rest and freshen up, Mr. Unwin," said Isabel. "Join us in an
hour for lunch." She turned to her husband. "You'll have lunch at home today,
won't you, Alex? Surely you've done enough work for one day."
**Oh, sure, dear. You heard about the..."
"Yes," she said firmly, in a tone indicating she didn't want to discuss it front
of Phil.
Alex turned to PhU. "Show T.T. to his room, son. You know the one. We'll see you
in about an hour, I guess, T.T."
"Fine, Alex. Until later, Mrs. Holder."
Phil led Holder through the shadowy cool lanai onto the flagstone path behind
the house.. The path ran under a low arcade, wooden beams with a tiled roof
overgrown with flow-'ering vines. The arcade connected all the living quarters,
winding through an arboretum of exotic trees and shrubs and ferns.
Unwin's quarters were hi the low building that contained apartments for single
lab workers. Phil set Holder's satchel down inside the door. He remained
standing outside when Holder walked in. "See you later, Mr. Unwin," he said,
taking a backward step.
**Wait, Phil," Holder said quickly. "Have you got anything
planned for this afternoon? I could use a tour."
"Sure, I guess. I didn't have anything special planned." "Look, call me T.T.,
okay? I'm not used to being a
�Mister.'"
'Phil shrugged, adolescent for "Whatever you want." Holder stood speechless. For
the life of him he could think
of nothing to keep the conversation going. "Okay. See you
later. Thanks."
Phil fled instantly. Holder watched him running away, feet
,56
RE-ENTRY
and elbows flying, back to the house. Holder, alone in the little room that he
already knew so well, felt like an interloper in territory that rightfully
belonged to the eagerly departed Un-win. He unzipped his bag and took out the
few clothes it contained. There were hangers in the single closet. In a few
moments he had put away everything he owned.
He sat down on the folding bed and stared at the wall. Maybe he'd take a shower
in a minute. There was lots of time to kill. There would be lots more time to
kill, in the future.
76
"Welcome to Darwin! Whether this is your first visit or your hundred-and-flrst,
we want you to have an enjoyable stay....
*� �
"You may have heard rumors about Darwin's Uniform Code of Natural Human Life--
there certainly have been some tall tales! So let's make it clear right now, we
don't deport twins! But seriously --the only thing you need to remember about the
Uniform Code is that it applies only to permanent residents. We respect the
customs of your home just as we expect you to respect ours. We're not
prejudiced--if you're a clone, even if you're a mosaic!-- whoever you are,
whatever you are, if you're a visitor, you are Welcome to Darwin!"
(from Welcome to Darwin, a publication of the
Darwin Visitors Bureau)
Almost a month after Holder reached Camp Owen Gorge the robot monitors orbiting
Darwin Station detected an unidentified, unannounced ship emerging at well over
a third of light speed. The monitors flashed an alert to Traffic Control.
Traffic Control would do its best to intercept, but, as frequently happened, it
would fail. Customs officers would at-
RE-ENTRY
87
tribute failure to the superb equipment carried by smugglers; the high price of
contraband made a large capital investment in evasion gear affordable and
worthwhile.
Customs could not know that the invader's equipment was so advanced no money of
the time could have bought it. The Earth ship was Sprint class, Security's
fastest and most sophisticated recon and infiltration classification, with the
advantage of thirty years' technical refinement
"Darwin's Star," Claymore said. She was relieved, and she felt a bit smug.
"Despite all your fears, we made it." She switched the control computer to
deceleration sequence. The freely falling ship began to wheel slowly in space.
Sirich watched the drifting stars through the unshielded windows. She smiled
faintly. "I wonder if we were the only ones?'
Claymore brushed auburn hair from her hazel eyes, "That hardly matters,
Clarissa." One might still compare the heart-shaped face of this Claymore
Doppelganger to that of the Mono Lisa--for on the Earth she'd lust come from
Leonardo had painted a -woman -with auburn hair.
"You're right," the Sirich Doppel said. "The only reality that concerns us is
the one where we are."
The main engine fired and the ship began its long descent Almost as an
afterthought, Angelica Claymore reset the clock.
Stage Two: Darwin, 176 N.F.

77
Kani paused, motionless on the sun-dappled ridgetop path, lifting his golden
head higher in the fragrant air. He sniffed. Amid the perfumes of the pines and
grasses and wildflowers he noted the peculiar musky-dry odor of triceratops.
He moved along the path, seeking an opening in the close ranks of pine and
juniper. At a bend in the trail the trunks thinned. Below, the narrow canyon
wound toward the great Gorge of the River, while behind him, hidden by dark
branches overhead, the slopes of the Mountain of Vapors rose gradually for many
miles into the realm of the sky demons.
A gust of wind blew up the canyon, quivering the ruffled leaves of the gingko
trees. With it came olfactory evidence of at least a dozen of the big
herbivorous dinosaurs, not far off-' and of something else as well. Kani
wrinkled his nose. In this heat it didn't take a sensitive nose to identify the
stink of a crowd of sweaty humans.
He stared for a moment at the small sun-dried red clay statuette he carried in
his right hand, a crude representation of a tyrannosaur. He was taking it to the
Shrine of the Spring, a day's journey from the village, partly to ask the help
of the Goddess, partly to be away from the village on the day of the .Trader's
annual visit. He had contributed nothing to the piles erf colorful hides the
adult hunters would offer, and he could not endure their mockery. No one in the
village bad seen a real tyrannosaur within living memory, but Kani thought that
if he were going to offer only a model he, the least of might as well offer the
greatest of creatures, placed the figurine in the crook of a shaggy juniper. ed
now by any implement except the long coil of ">grass rope that hung from his
shoulder, nor by any scrap of except a twist of string around his loins--and of
spurse his necklace of trade teeth, the badge of an initiate--
91
92
RE-ENTRY
he left the trail and began working his way down the slope through a thick
tangle of brush.
Skirting an impenetrable thicket of oleander, he darted through a grove of
ginkgos, his golden skin and hair bjending so well with the shimmering light
from the green-gold trees that if he had merely stood still he would have become
instantly invisible to any watcher.
Now he could hear the rush of water over rocks, and over that sound an
occasional whistle or shout, which fired his curiosity. He could see nothing but
a glittering mosaic of translucent leaves. Even underfoot the fallen leaves were
thick, cushioning the tread of his bare feet.
Abruptly the slope became steeper, falling off sharply ia a treacherous slide of
wet leaves and slick red mud. The stream was loud now, and the ah* was cool with
spray, and still he could see nothing. Cautiously he crept along the bank,
screened from the invisible rushing river by a tangle of wild fig branches.
He came to an immense lava boulder thrusting up through the net of leaves and
branches. The rock's steep, faceted sides were thickly upholstered with bright
green moss--his fingers and toes wriggled for holds hi the treacherous matting as
he pulled himself to the top. He emerged into sunlight, suddenly conscious of
his bright conspicuous hair. Flat on his stomach he wormed forward to the edge
and peered over.
What be saw stunned him.
A line of great leathery creatures splashed upstream over the rounded boulders
of the river. Many had already passed and gone on npriver, and many more still
approached, ponderous but unimpeded. Their tiny amber eyes shone dully in their
massive beaked heads, which were imperially crested and horned with long pikes
of bone. Long hind legs and short forelegs propelled them forward, sure-footed
but rhythmically lurching.
Kani had seen families of triceratops before, whole herds moving in habitual
single file as these creatures did. What made him stare in fear and astonishment
were the riders. On each broad back- where it sloped sharply down from elevated
hips rode a man or woman, swaying to and fro hi a nest of boxes and bundles. He
knew them immediately by their uniforms of green and brown, and by their black
skin: Rangers.
Kani had thought Rangers were merely the exaggerated villains of old husbands'
tales, evil bugaboos useful for scaring bold children. Occasionally the old
folks would point to a sky
RE-ENTRY
93
. machine passing high overhead and identify it by its spinning wings as a
Ranger's. Yet here were men and women riding on the backs of dinosaurs, an
occult power possessed only by demons of the dark forest and the mountain mists--
or by Rangers.
Kani watched fascinated, scarcely daring to breathe, as the colossal caravan
stumbled to a halt Just below his eyrie an animal stood stolidly in midstream,
waiting, while the animals in the lead left the river bank and, urged on by
their riders, began clearing a path up the far slope of the canyon. Their long
horns rooted out bushes and tossed them aside. Clouds of dust and insects rose
around the riders, who constantly whistled and clucked. The triceratops moved
mechanically ahead. Kani could see that an hour or so of such work would succeed
in beating a broad trail up to the open pine woods on top of the opposite ridge,
the edge of a broad plateau. The dinosaur riders were heading into the black
forests west of the great Gorge, where even the people themselves rarely
wandered. What could Rangers want so deep hi the people's country?
Kani studied the pair nearest him, an old man of perhaps forty seasons, and a
soft-looking youth, both perched on the back of the triceratops that had stopped
below his rock. They certainly looked human enough, except for their black
skins. They were gabbling Ranger talk to each other, and Kani strained to hear
what this exotic speech might sound like.
His skin prickled. Had serpents licked his ears in the night? It was the same as
the people's speech. He could understand what the Rangers were saying,
The night approach terrified Claymore, despite her faith hi the Spruit and its
programmed landing instructions. Outside the windows jagged pinnacles slid past,
shifting hi the light of the racing moon. Then the slender ship slowed, to
thread its way between desolate scarps toward a glacier-hung cirque. Supported
on nearly invisible columns of blue flame, the Sprint lowered itself onto, and
then into, the ice. They had landed only forty kilometers from Cuvier, but they
were several thousand meters up hi the rugged Lyell Range.
In the dim green glow of the cramped cabin Claymore �tripped and began pulling a
thermal suit over her long, bare limps. The suit looked no more complicated or
elegant than old-fashioned long Johns, but it was all she needed to survive the
freezing journey ahead.
94
RE-ENTRY
RE-ENTRY
95
Sirich watched from her couch. "I suppose it*s into the deepfreeze for me?" she
remarked in resignation.
Claymore smiled. "We've been over this, Clarissa. I just can't justify taking
you. I'll leave you a wake-up call in case something happens to me."
'T have no motive for helping Phil any further, Angelica, especially since you
assure me you mean him no harm. And I could be useful."
"Clarissa..." Claymore had to break off as she pulled the upper half of the suit
over her head.
Sirich took advantage of the other woman's momentary helplessness to press her
case: "I've been to Darwin, I know the administrative procedures. You know I can
manipulate a computer--in case there's a problem with your forgeries. It is
thirty years earlier, you know. Before your time."
Claymore settled the suit under her breasts and sealed the waist seam. "Thirty
years less a month," she reminded Sirich. "Maybe youVe already helped Holder to
a head start"
"One month hi thirty years is less than three-tenths of a percent error with an
experimental technique. We don't even know Holder's gotten here yet himself 1 Or
maybe he's been here a year already. You're unfair. And besides ..."
Claymore went about packing, listening to her friend's arguments repeated for
the third or fourth time. Nothing Sirich said was new, nothing was compellingly
persuasive--yet now there was some indefinable element: the calm, insightful
manner, perhaps, the words that came just so, in response 'to thoughts Claymore
had not yet spoken, or the undercurrent of trust, of love... With astonishment
Claymore realized she was changing her mind.
78
Fingernails scratched at the door post "Come in, Meria," said the Mother.
The priestess Meria pushed aside the curtain of pebbled
crocodile leather and stepped into the Mother's house. "He's almost here,
Ariana," the tall blonde priestess said. "One of the men saw his sky machine
circling against the dawn."
"Help me with this, Meria." The Mother Ariana turned so that Meria could reach
the clasps of the heavy choker that lay over her breasts; it was a massive
piece, constructed of ankylosaur bone plates studded with beaten river gold.
"This old thing is not only ugly, it's impossible to put on."
*This is the symbol of your power, Mother," said Meria, faintly scandalized,
though by now she should have been accustomed to Ariana's bluntness. She tied
the choker's thongs, then stepped around to check Ariana's coiffure and her palm
fiber skirt, as golden as her hah1. "You are fit to receive the Trader now,
Ariana," Meria said with satisfaction.
"How gratifying. I wish he were fit to receive me," Ariana said sourly.
Meria kept a politic silence; she fussed with the food and drink laid out on the
trestle table, the smoked fish and the fresh figs, the deviled lizards' eggs,
the turtle meat the wine, theama. , Ariana watched her a moment then said
impetuously,
**Meria, I will not receive the Trader here. Offer him refreshment. When he has
stuffed himself, bring him to me hi the village shrine." Ariana left the
surprised priestess standing by the table.
Outside her house the men were already gathering, chatter-Ing mindlessly as men
do, resplendent in their capes of colored leather, their necklaces of teeth,
their headdresses of painted bark sparkling with the bright green carapaces of
tiny beetles. Stacked on each side of Ariana's woven-mat house were piles of
crocodile skins, ankylosaur and scolosaur hides, triceratops horns, whole
pteranodons stretched on wooden frames. The huge arch of the cave roof, the
uncollapsed roof of the lava tube that sheltered the entire village, soared
above the gay crowd.
, The men grew silent as Ariana strode through their midst, toward the ravine.
For the Mother to leave her house before the Trader arrived was a departure from
tradition. They had no idea what to make of it
She found the narrow path to the top of the deep ravine
and soon left the puzzled villagers behind. She would start a
, new tradition today; she would receive the Trader hi the shrine
�--not because of its beauty, still less because of its religious
96
RE-ENTRY
RE-ENTRY
97
associations, but because of its acoustics. Voices from the ravine might float
up to the shrine, but what she and the Trader said to each other on top of the
cliffs would remain their own business. That she must deal with him at all
galled her more with each season.
The symbiosis of Trader and people extended back beyond Ariana's ability to
reckon. Farther back than her mother's mother (whom she could remember, but did
not like) she knew only the names of ancestors, with no scrap of personal
history to give them breath or business in the world.
_Of course she knew the legends. They had been taught her not by her natural
mother, but by Ariana her predecessor. Her real mother had died when she was
eight or nine, her father a year later.
The people pitied orphans but did not value them. A girl without parents could
not pay a groom price, and she was regarded with open suspicion by the mothers
of eligible young men, who naturally hoped to make the most advantageous matches
possible for their sons. Vera--Ariana's given name-- drifted from relative to
relative, learning to keep her mouth shut and her eyes and ears open. An
outsider in her own community, she thought much on the customs of the people,
and decided that not everything she saw was self-evidently wise and good.
Vera was fifteen when the natural Successor, a girl her own age, died of
disease. She was as startled as everyone else when, after a suitable period of
mourning, the old Mother Ariana claimed that the Goddess had appeared in a dream
and commanded her to name Vera the new Ariana.
Then began the most intense year of her life, much of it spent beside the bed of
the ailing Mother, wreathed in thick clouds of herbal smoke. All the while
suppressing the urge to choke, she ingested what she could of the lore that was
droned at her incessantly, night and day. She learned of the day when there were
"cities" on Bounty--great piles of stone filled with people--and farms that
stretched from horizon to horizon. In those days the ancestors of the people had
not been farmers, for with machines to do the work there was no need. Instead
the people had led a carefree life in the forest, selling sweet illicit herbs to
their town cousins, who frowned on their way of life but bought their produce
nevertheless. Then, surely, the people had all that the Goddess and life itself
could have given them.
Then came the Death, and the Demons, and the Creatures of Darkness.
The new Ariana learned these stories well, but she learned -more. She learned
the old Ariana's doubts and opinions and plans. The old woman had truly mourned
the loss of her daughter, but she had chosen the new Ariana with shrewd purpose,
hoping through her to perpetuate her preparations for a day when the people
could farm openly, and openly sell the produce of their gardens, and speak with
then* own voices in the councils of the world in which they lived.
And do away with the cynical criminals who dignified themselves with the title
of Trader...
Ariana reached the top of the cliff and entered the shrine through the gap in
the little withe fence. The sun was almost up now, and the sky beyond the
shoulder of the mountain was brighter than die gold on her breast. Dark
cypresses brooded over the shrine.
In the center of the uneven pavement of river pebbles stood a boulder of green
jade, a pedestal for an awkward, tied-vicker contraption that only an initiate
could have recognized as a model of the great robot plant processors that once
prowled the wide plains of Bounty. The reliquary contained a bent and rusted
scrap of iron said to have been, once upon a time, an actual part of just such-
a machine. Ariana seated herself on a bench in front of the quaint idol to wait
for the Trader, the living symbol of the people's present predicament
Evidently the Trader had decided to skip his breakfast, for only a few minutes
passed before Meria appeared at the gate of the shrine, leading the visitor.
Leaving him at the gate, Meria turned and quickly disappeared down the path,
Ariana rose and took a step toward him, extending her right hand in the manner
customary among outsiders. "How pleasant to see you again, Mr. Langoza," she
said coolly.
Langoza stepped forward jachntily and took her hand, squeezing it a little too
hard. "Delighted to see you looking so good, Mother.*'
Aziana thought perhaps he was not delighted. Perhaps he'd hoped to find her dead
by now; she was over forty seasons, after all, and Langoza may have hoped to be
dealing with her daughter, the Successor, who at sixteen was barely an adult
Langoza was a contradictory fellow, conservative-looking if one went only by the
dark face framed by neatly trimmed black beard and hair greying at the temples.
But he was rak-
98
RE-ENTRY
RE-ENTRY
99
ishly dressed in black boots and trousers, and he wore an open shirt of the
softest yellow leather from the wings of a pterano-don. On his bared chest he
sported a necklace of gorgosaur teeth, after the fashion of. an Initiate. Ariana
suspected he wore it to mock them.
She gestured at the bench. "Sit down, Trader. Tell me all your news. After I've
heard what passes in the world outside we can relax with a pipe and a bowl, and
I'll show you some trophies."
"Sounds great, Mother." He sprawled on the bench.
She sat facing him, as far away as she gracefully could manage.
Langoza assumed a sad look. "I'm afraid I got one big disappointment for you,
Mother. You indicated to Mr. Wilson when he was up here last time that you
desired to obtain certain specific drug items. I regret to tell you we just
can't get 'em. We done our best, but these substances are controlled very
rigorously here on Darwin--excuse, I mean Bounty-- and on the other worlds, well,
the demand ..." He trailed off, as if unwilling to say what he meant, that
Ariana's people could not possibly afford them.
The news hardly surprised her; indeed the story was always the same: modern
medicines, modern tools, electronic devices for counting and time-keeping and
for communicating across distances, somehow these things were never available,
or only at exorbitant prices, in amounts so meager as to do nothing but whet the
appetite. On the other hand ...
"We got a terrific supply of cotton prints, some good iron knives, and a
collection of beads that'll knock your eyes out," Langoza said with a broad
grin. "And a very rare collection of teeth!" He waited for her exclamations of
delight.
She looked at him without expression. Then she forced herself to smile as
broadly as he. "The young men especially will be delighted to hear it, Trader.
And what of the rest? Do you have needles, and fine, tough thread to go with
your pretty cloth? Are your knives made of proper steel?--or are they like the
last bunch, as rusted and soft as the heart of our venerable relic here?"
She listened to his ritual assurance of the quality of his goods with only half
an ear. This stereotyped haggling wearied her unto death. In her own aching
impatience she sensed the beginnings' of change in the world, the coming of a
time to
throw caution and dissembling aside, along with all the dark old superstitious
ways.
Langoza too seemed to sense something; his too-jovial manner betrayed his
growing wariness of her. "Say, I almost forgot, Mother--and you asked for news of
the outside!--I heard ft on good authority those Rangers are bringing
tyrannosaurs back to your neck of the woods. Won't that excite your young
bucks!"
Ariana stared at him, jolted from her reveries. This news must not be spread
through the village. She could imagine an orgy of frivolous young men rushing
off, deserting their gardens, each eager to be the first to bring down the
ancient prize. For Mother Bounty was said to love the blood of this beast above
that of any other. Not to mention the Traders... "You must tell me more about
this," she said as calmly as she could. "But privately. I don't want to unduly
excite..."
"Sure, I can understand that," he said, blithely cutting her off. "Especially
when they find out how much me and my associates are willing to pay for just one
honest-to-God rex hide." Langoza laughed. "Hell, your boys would cut each other
down to get first crack, won't they?"
She looked at him bitterly, recognizing the threat. "If the rumor is true, I
will be happy to supply you with all the hides I can obtain. And since these
hides are so valuable, you in turn will no doubt be able to locate a supply of
the medicines we mentioned earlier."
He just kept grinning.
Ariana went on sternly. "But you must let me handle this my way, or there will
be nothing ,for you. Nothing, do you understand?"
"There's other tribes," he said, his grin stiffening.
"Go to them with my blessing."
: **Well, they ain't so advantageously situated as you people." 'He gave her a
poisonous look. Then he shrugged. "Okay. I'll 10 along."
.   "Good. You see the matter as I do. We can proceed..." smiled.
entered the mouth of the ravine with automatic whistling the signal that warned
the guards of his ap-. Tbe ravine had formed with the collapse of the huge tube
centuries earlier, thick, rich soil had built up on its
100
RE-ENTRY
RE-ENTRY
101
floor, supporting tall hardwoods draped with flowering vines, and spiny cycads
and sturdy tree ferns--plus the people's most productive gardens.
As he moved into the green shadows under the trees he noted the Trader's big
black sky machine parked just under the trees at the entrance to the ravine, its
long wings folded into its sides.
The daughter-Ariana was sitting where Kani had hoped to find her, under a canopy
of acacias near the mouth of the main cave. On the other side of the pool at the
cave mouth the men of the tribe milled about hi their finery. Ariana and her two
half-sisters ignored them, concentrating on the long fibers they deftly twisted
into rope. Ariana was making a lasso for her own use, while the efforts of her
skinny sisters, still at the apprenticeship stage, would find some use in fence
building or roof repair.
"Hello, Ariana," said Kani, trying to sound casual, though his chest was aching.
"Where are you going, Kani?" she asked quietly.
"To see your mother,** he said. His fair skin burned with pride. "To discuss an
offering."
Ariana gazed at him with pale blue eyes. Her sisters stopped then* work. Maya,
the older of the two, sniggered. Ariana looked down and resumed rolling and
tugging the fiber cords between her strong fingers. "It will take more than the
offer of a doll to interest my mother,'* she said, her voice hinting reproof.
This time both Maya and her sister laughed, and Ariana silenced them with a
stern glance.
"Though I have no house or garden yet, my offering will...** Kani stopped
himself, then continued less prompous-ly, "My offering will interest her, I'm
sure."
"I pray that it does, Kani." She smiled at him wanly. "You will excuse us now,
please. Apparently my infant siblings can not work and eavesdrop at the same
time. Our mother's displeasure will be severe if they do not finish what they
have started."
The little girls gave her withering sidelong glaces, but made no audible
protest. Kani nodded at her, half raised his hand to say goodbye, and went on
toward the main cave.
Beyond the deep blue-green pool at its entrance, the stone arch, hung with
ferns, sheltered whole houses of woven mat and thatch. The gathered hunters
ignored Kani as he pushed through them toward the Mother's house, the longest
building
in the cave. The priestess Meria and her brother Leri kept watch outside the
Mother's door; the warrior priests were the Mother's prececessor's sisters'
children, and held the guard duty by hereditary right. Kani went boldly up to
the man.
"What do you want, Kani?" Leri asked lazily, not bothering to get up off his
haunches. Leri was tough and scarred, at least thirty seasons old; his long
yellow hair and beard were streaked with gray.
'"I want to see the Mother. About an offering."
On the far side of the doorway Meria snorted, not bothering to hide her
contempt.
"You were young once, I think,*' Leri said to his sister. He looked at Kani with
sympathetic eyes, but he shook his head.
Kani flushed. "It is my right to see the Mother when..."
**Yes, yes. Not when she's with a Trader, though." Leri got to his feet,
stiffly. "Take a walk with me, Kani." Before Kani could protest, Leri draped a
heavily-muscled arm across the younger man's shoulders and drew him away,
through the throng of jabbering men, toward the dark pool at the mouth of the
cave. Across the clear, cold water Kani could see his beloved and her sisters,
blazoned in filtered sunlight, working patiently.
Leri followed his gaze. "You're a lucky man, Kani," he said confidentally. "I
think the Mother likes you well enough to give you a bit of time. And the little
Mother will wait for you forever, by the look hi her eye." Leri turned to face
Kani. His bronzed face showed the deep creases of maturity, and he was not
smiling. "So don't make a fool of yourself and lose your chance. Work. Gain a
reputation. Build a house and prepare a plot--you've got to prove you're worth
the groom price, man! Forget this talk of an offering until you have something
the Goddess won't sneeze at."
"But I have, Leri, I have!" Kani said excitedly. "And I be-Keve the Goddess
herself has delivered the offering into my hands, for I was on the way to her
with a doll of the tyran-fiosaur when ..."
�,,;- "What are you yammering about, boy?" Leri asked gruffly. ."The best
offering of all, Leri. Tyrannosaurusl I know jifhere to find one!"
;f Leri grabbed the younger man's jaw between horny thumb �nd fingers,
effectively silencing him. He pulled Kani's face jteward him, searching for
signs of illness. Kani flinched, but ltood rigid until the inspection was
complete. Leri dropped his
102
RE-ENTRY
hand. "None have seen a living tyrannosaur in my lifetime. The Traders say they
live only in the dawn lands, guarded by demon Rangers."
"But the Rangers are bringing them here! Fve seen Rangers with my own eyes--
yesterday. I heard them talking--I was no further from them than I am from the
pool there, and I heard them tell how they will bring tyrannosaurs back to the
deep forest."
"You heard them? You understood them?"
"They spoke the Speech, although so badly I wanted to laugh."
"When did this happen?" But Leri didn't wait for the answer. "No," he said.
"It's not my place to hear this story, or to judge it. You wanted to see the
Mother. Now you must see the Mother."
"Yes, he must," said Ariana's voice behind them.
They whirled to see the Mother herself standing a few feet away. Her aegis of
gold and ivory glowed terribly in the cave's dim green light. Leri and Kani
dropped to then- knees and bowed their heads.
Behind her the other men of the tribe, bright as scraps of trade cloth, pressed
forward, peering and straining to hear. Ariana turned to the dark Trader who
stood beside her. "It seems your information was accurate, Mr. Langoza."
Langoza nodded smugly. "Ain't no secrets now, Mother.**
"/ choose who hunts Tyrannosaurus," she replied angrily. Her rich voice
reverberated from the curved stone ceiling, and even Langoza flinched away from
her. "No man will leave his gardens without my permission." The men muttered in
dismay; she waited until the grumbling died, then looked at Langoza and at the
kneeling Kani. "Both of you want die same thing for reasons of your own. Is it
wise to let either of you have what you want?"
"Mother, you're wisdom incarnate," Langoza said, trying to be smooth, but
managing only to sound frightened. "Whatever you decide."
"Come with me, Kani," she said with annoyance. "And you, Langoza. 'Wisdom
incarnate* has questions for you both."
79
A stiff breeze whipped the blue-gray water to whitecaps. From the granite
breakwater Angelica Claymore faced the fresh wind, filling her lungs with tangy
air. Space 1 Everywhere she looked...
Gulls wheeled and screamed, and far out in the Kenyatta Inlet a sailboat beat
upwind under close-hauled snapping canvas. The ah* was clear beneath gray clouds
that jostled each other all the way to the horizon; across the inlet Claymore
could see the granite cliffs of the Lyell Range rising up, sheer and grim, into
the clouds.
The Esplanade that ringed Cuvier was bigger than the city itself; the park held
at least one specimen of every tree and ghrub and moss and flower that grew
anywhere on the planet Through the gardens wandered a collection of animals that
would have confounded Noah.
Darwin's largest city was a village by Earth standards, with a resident
population of some 200,000, and, on a typical day, half again as many tourists.
Architecturally Cuvier was forgettable, a collection of practical polysteel and
bright plastic boxes arranged on a simple grid plan. The important buildings,
the Institute and the major hotels, were distinguished only by their rambling
size. But the buildings were virtually invisible beneath a teeming reticulum of
life, a profusion of fruiting and flowering, stickery-sticky, climbing,
creeping, twisty-twining, budding and blooming vegetation. The birds and insects
were almost as various, and if anything more numerous--so much underfoot and
overhead that fastidious tourists complained. Claymore gloried in the
hurlyburly; her heart lifted with every bird song, with each chitter and buzz
.and cluck of gecko or cricket or frog. She did not mistake diversity for
freedom, but this tame nature seduced her.

Earth Security had supplied her with good programming data, or so it had seemed.
She and Sirich had bad no trouble
103
104
RE-ENTRY
RE-ENTRY
105
getting rooms at the Burton, the city's largest hotel. They'd put in
applications for travel permits on the basis of memberships in a big tour from
Earth, and had expected routine overnight approval. This morning they should
have been on their way to Copeville aboard the daily airship.
Then- room terminal had politely informed them of a temporary processing delay,
and had reminded them that they were not to venture outside the limits of Cuvier
until their permits had been approved.
Sirich had volunteered to check into the problem, and Claymore encouraged her to
find out what she could. They agreed to rendezvous on the Point of the Esplanade
at noon.
Claymore waited in the open air, ocean behind her and a clear field of fire in
front--for Sirich or anyone else who kept the appointment
The woman known as "See" was in Special Projects when the urgent call from
Intelligence reached her. Though she'd had many decades of experience
controlling her emotions, she was angry. To participate in the experimental work
in Special Projects was one of the few remaining pleasures hi a life otherwise
occupied by administrative trivia. She had left instructions that she was never
to be disturbed during her rare, too-brief visits to the floor.
She took the call in the SP chiefs office. Waiting for the connection, she
lightly touched a finger to the little muscle between her brows, an old trick
useful for releasing tension in the facial mask. This year her skin was smooth
and brown, her hair long and black. She looked about thirty-five, an age
appropriate to her presumed life history. Few people on Darwin knew her true
age. Jim Asmussen of Intelligence was one of them, however.
The communicator block coagulated and Asmussen's features appeared. "I
apologize, See, sincerely. But I have to know how you want to handle this."
"You wouldn't call if it weren't important," she said automatically.
"Yesterday Abramian picked up a couple of tourist applications with phony
documentation. The counterfeit was superb. He says the computer wouldn't have
caught it, except his people were tipped."
This was hardly news. As head of counter-smuggling opera-
tions Felix Abramian handled situations like this several times a month. See
waited for the punch line.
"He sent a couple of plainclothes people over to the Burton this morning, but
they only nabbed one of the suspects. She offered no resistance. In fact she
claimed she was the one who tipped them. She asked to see Abramian in person.
She asked for him by name, so naturally they complied."
"Where is she now?" See asked.
**In his office," said Asmussen. "When she got there she started giving him
orders! She wants him to put the phony applications through. She wants him to
'stay out of her way for a couple of weeks*--her words. Though she did offer to
check in with him once in awhile if he'd like.**
"How considerate."
"She said if he had any questions he should ask me, and if I had any questions I
should ask you."
"She knows who we are?"
"Here's her profile, See." Asmussen reached to the side; his image was replaced
by a three-dimensional colored graph, a genetic abstract Asmussen let it stay in
view only a moment before he said, "And this is what she looks like in person--
live from Felix's office."
The head of an old woman appeared in the communicator. She wore her salt and
pepper hah* cropped close, and she looked very old. She was smiling patiently.
"Okay, Jim, that's good enough," said See.
The old woman's image was replaced by Asmussen's face. He looked at his boss
inquisitively.
She thought in silence. This wasn't in her plans; she had no explanation for it;
she was mightily curious--it was the first really new situation she'd encountered
in well over a century. She should pry into it get all the details, all the whys
and wherefores.
But she resisted the immediate prying urge. She was wise enough to know that
wisdom came from patient observation. There was some deep game afoot and clearly
she would learn more if she did nothing more than wait. Meanwhile, why spoil the
suspense?
"Give her what she wants, Jim,** she said at last She was surprised to find she
felt like laughing. "I don't know what Pm up to or how I got here any more than
you do, but I'm inclined to trust myself."
Asmussen nodded. "Right, Clarissa."
206
RE-ENTRY
RE-ENTRY
107
Claymore watched Sirich's erect, spry figure make brisk progress across the
emerald lawns of the Esplanade. She'd kept the appointment to the minute. From
the satisfied look on her face she'd accomplished whatever she'd set out to do.
As she came up to Claymore she produced a pair of slim plastic code chips from
her raincape pocket. "Unrestricted travel. And an apology for the delay."
"Excellent," said Claymore. It appeared Siiich had not betrayed her after all.
"What was the problem with the documents?"
"Nothing. Your people had the right code, but we filed early, before the Customs
computers were through processing. They bounced every application on the list--
over six hundred people--and thought it was then- own famtl"
Claymore sighed. Learning to hold steady and wait out the inevitable
coincidences had been an early part of her training. So why this vague
disappointment? Was she looking for trouble? Perhaps she'd hoped the mission
wasn't going to be over with as quickly and efficiently as her superiors wanted.
From Sirich's eyes, bright with excitement, she realized the older woman was in
no hurry to get back to Earth either. Claymore turned to stare at the gray
cliffs across the water. The wind blew long strands of her auburn hair across
her eyes; she reached up and hooked them out of the way. She wished she could
stay here in Cuvier until the weather broke and the sun came out, until the
rising sun shone full upon the glacier-crowned granite.
But she was not free to linger.
20
Holder stared at Phil hi exasperation. "Not 120! You're supposed to be counting
the permutations of five things, two of them equivalent to each other, and the
other three also equivalent." Holder ran his tongue over his teeth; he could
fight a crocodile for a double martini right now. It was hours
until sundown, which would be strictly by the clock today, and no one on the
expedition touched a drop before then. Phil sat cross-legged on the plastic
floor grid. His sullen expression was eloquent as he stared at the sheet of
water pouring off the edge of the rolled-up tent wall only centimeters from his
nose. Inside the tent the air was cool but sticky; outside, the dim outlines of
other tents and the pale shapes of trees at the edge of the high meadow were
barely visible through vertical curtains of rain.
They'd had to set up camp hi the rain. They'd had to lute up for most of their
meals hi the rain, waiting outside the mess tent huddled together in panchos
that let water in at the neck, standing in mud up to their ankles.
"So?" Holder prodded, pressing the projector stud to make the aerial display
wind back.
Phfl refused to look at Holder, or allow the projector's beam to catch his eye.
"So what?" he grumbled.
"So, five factorial has to be divided by two factorial times three factorial!"
Holder sped through the simple equation, then yanked the mathfile out of the
projector and tossed it angrily aside. It bounced off his tightly-made cot "How
many times do I have to repeat the same problem? How do you ever expect to be a
biologist if you can't handle simple combinations?"
*The great Darwin didn't need math," Phil said sarcastically.
"Darwin needed it and he knew it," Holder snapped. "He at least was sufficiently
intelligent to regret his ignorance."
The boy opened his mouth to say something, but then he turned away, humiliated.
Too late Holder repented; the slashing debater's style he'd honed in a lifetime
of academic infighting was worse than useless to him here. He was making Phil
hate math and every other subject he was trying to teach, just as Unwin had made
him hate them.
Was the situation everything, then, and personality nothing? He would not
believe it He was simply not applying the lessons he should have learned from
his own experience, even his experience of this very tent, this very rain.
He sighed heavily. "Let's drop the schoolwork for awhile, PnU,** he said, "I
don't like being cooped up like this any better than you do."
Still Phil said nothing. He sat as far away from Holder
108
RE-ENTRY
RE-ENTRY
109
as he could get, his chin planted on his hand, staring at the green wall of
water and the gooey red mud it was churning into soup, and listening to the
torrents of runoff that gurgled beneath the floorboards. Nothing could swim,
fly, walk, or even comfortably sit still in weather like this. Except dinosaurs.
They probably liked it Off at the edge of camp the triceratops in the remuda
looked positively frisky.
"So'd Frank take you to the site yesterday?" Holder asked, trying to sound
casual.
"Yeah," Phil answered. He stirred at the mention of Frank's name, as Holder had
hoped.
"It was nice of your Dad to give you a place in the cages,** Holder continued
cautiously, trying to draw Phil out.
"It's not exactly a favor. Dad knows I'm good with a recorder."
"He showed me some of your work. Excellent." Holder hoped he didn't sound
insincere. He'd never thought that much of his own movies.
"Yeah, thanks." Phfl rocked back on his hands. At the thought of the holography
assignment his mood began to lighten. "It was probably Frank who gave Dad the
idea. I know it was him that persuaded Mom to let me come. She doesn't want me
to do anything."
"She has slightly different priorities, that's all."
"And Dad wouldn't even have stood up to her if it weren't for Frank," Phil went
on, warming to his grievance. "Sometimes I wish..." He stopped.
(... that Frank was your father instead of Alex, thought Holder.) He changed the
subject; to be party to Phil's disloyal thoughts was treading dangerous ground.
"Why d'you think they picked that particular site?"
Phil looked at him directly at last- "You really don't know a whole lot about
dinosaurs, do you?" He was honestly puzzled that a man of Unwin's inexperience
should have gained such a high place in Alex Holder's estimation. Dumb luck was
the only possible answer.
"I only know what I've learned since I've been on Darwin.**

"Well... you know what ethology is?" Phil looked sidelong at Holder. Holder
nodded. "Well, the site's perfect if you know a little bit of dinosaur
ethology," said Phil, savoring the impressive word. "Tyrannosaurus isn't a
social carnivore. Tyrannosaurs hunt alone usually, sometimes in pairs."
Phil warmed to the lecture with quick enthusiasm. Holder,
amused to recognize the roots of his own style, listened solemnly.
"They're good parents when the little ones are still little, but as soon as they
get big enough to leave the nest the adults chase them off. And the ones that
don't run fast enough get eaten. It takes a big range to support a rex, where
the prey isnt artificially abundant--like around the hotels."
�^That's not the case up here."
"No, this is really wild country. Even Rangers don't come up here much, except
to do population counts. The dinosaurs are on their own, like Dad says. He's
real proud of it. That means the rexes are going to have to work to survive."
"So Frank and your Dad picked especially good hunting grounds for the first
transplants?**
Phil nodded. "A redwood valley, which means plenty of cover but not much
undergrowth. And a resident herd of tops. The Rangersll stake down some little
tops until the rexes get used to eating them. After that they'll be on their own
too." Phil paused, his glance flickering shyly away from Holder. "Mr. Unwin...
T.T...."
-Yes, Phil?"
Tin sorry about before." He waved at the mathfile. *1 know I've got to work at
this stuff..." He ran out of words.
Holder felt a rush of gratitude. "It's the weather," he said. He wondered at
Phil's sudden burst of maturity. For himself, he couldn't remember ever having
the courage to face up to his own rudeness, but maybe Unwin had never given him
an opening. "And Fve got to admit I'm a lousy tutor. I'm more comfortable
lecturing."
Adults rarely bothered even to explain themselves to Phil, much less apologize.
He grinned, and held out his hand. "Shaker1
Holder looked at Phil, and for a moment there was no sound between them, only
the drum and bubble of the steaming rain. Love welled up in him. He reached for
Phil's hand...
... and as he touched it everything turned sour. Holder felt nauseous, unclean.
He withdrew his trembling hand, felt Ms skin burn, sweat spring out on his
forehead.
He staggered out of his chair with a stricken groan, avoiding the boy's shocked
gaze. He brushed aside the netting at the entrance to the tent and lunged into
the rain.
His feet sank deep into the mud; greasy rolls of it curled
110
RE-ENTRY
RE-ENTRY
111
over his boot tops. He staggered and fell to his hands and knees, losing one
boot to the sucking mud. Water pounded his head and back. His ears roared. He
retched.
Now Phil was beside him, laying a nervous hand on his shoulder. "Mr. Unwin?
What's the matter? What...?"
Holder rolled away from him, shrinking from the awful touch of his
Doppelganger's hand.
He had committed an obscenity. He shriveled with revulsion; everything he was
doing was an obscenity. He was vaguely aware of green and brown uniforms
approaching through the exploding liquid veil of raindrops in front of his face.
Could he recover before they found him out? He must force these thoughts, these
disgusting thoughts, down and away before it was too late.
How dare he? How dare he love himself?
27
Once I had it right, and it was simple: all learning is the result of
repetition, from the "learning" of the developing nervous system to the simple
learning of stimulus and response, to the deep understanding of meta-learning.
Wisdom results from encountering the same phenomena over and over again, turning
them, as it were, in a crystal of differing contexts.
Holder and the medic knew there was nothing physically wrong with him; the medic
called it "four-wall fever," gave him a note for some pills, and assured him he
would feel better when the rain stopped. As if on cue, the rain did stop, and
before sunset the sun peeked under the clouds.
Holder showed up at the quartermaster's tent as the expedition's big cargo
helicopter was lifting off to take Frank Seaton back to Camp Owen Gorge, where
he would fetch the first tyrannosaur. Li, the quartermaster, went to find
Holder's packet of seasick pills. While Li was hi the back of the tent looking
for the seldom-used medicine, Holder prescribed for himself. He filched a liter
of gin from the shelf
trader the counter and tucked it into his belt, tinder his voluminous rain
slicker.
She showed me how I could make the ultimate test of my pat theories, how I could
realize my obsession of returning, repeating, re-entering experience. Then I
faced a choice: would I attempt to drastically alter the environment of my
upbringing--kidnap myself, murder my father in the grand old Greek way? Or would
I try to make a difference with small changes--like the random mutations that
affect an individual's genetic and physical makeup, but are of no consequence to
the species?
The bottle was half gone, and the pain had dulled, and the clouds were starting
to break up and blow away. The moon, that intense, bright spark, played hide and
seek as he sat huddled in the soggy eucalyptus. The wet leaves smelled sharply
of urine, their natural odor--he had not lost complete control of himself, yet.
/ didn't foresee this awful isolation. I had a vague faith in some kind of
mystical identity of self with self. What nonsense! 7*m two different people.
I'm even allergic to myself! How's that for mystical identity?
Both of us are real, both of us have our own histories-- only accidentally shared
up to a point--both of us have our own concerns for the present and our own hopes
for the future. Just because I know what his hopes are, just because they were
mine once, doesn't alter our differences in the least. I can't tell my little
twin brother of any of what I
-   know, and he wouldn't believe me if I did...
The gin sloshed in the bottle, blue in the moonlight Holder stared at it
I wonder what he thinks of me? I hated Unwin at first. Maybe I never got over
the resentment, though I started feel-Ing sorry for him later.
Unwin's potential as a playmate was a lot greater than the
tittle teacher robots I was used to, but that was offset--I
craved my parents' acceptance, especially Dad's. I desperately
wanted to impress them with my maturity, my personhood.
Vnwin got in the way of that, but good, with all his reports
''�', and helpful suggestions.
;,   Ok, I hated the folks too, sometimes, for failing to be
-"impressed. For insisting on treating me like a child. Oh, I'll
�;-;'*fe> a lot better when I grow up, I said, My kid'll get the
�,':�bitneftt of all their mistakes.
222
RE-ENTRY
RE-ENTRY
113
When it came to shaping Phil's future, though, he had only one advantage over
Alex and Isabel. He knew the events of the future, and that was less of an
advantage than one might suppose, since be couldn't ten anybody what he knew. Of
course when he could remember clearly he knew exactly what Phil was thinking,
but adolescents are notoriously easy to mind-read anyway. Countless generations
of parents before him had learned to their sorrow that merely knowing what's on
a kid's mind doesn't make him easier to talk to. It may make things worse.
Throughout months and years of planning Holder had had a thin, obligatory
appreciation of the difficulties he would face. He'd been driven by the
obsessive belief that somehow he would manage to overcome the barriers to
communication. Instead, he found himself in loco parentis. "The Child is father
of the man," the poet said. Now the man was father of himself.
Like a father, there were things he knew, experiences he'd had, agonies he'd
endured, joys that had come upon him unexpectedly, all of which he wanted
desperately to convey to this still unformed, not quite innocent being who was
him.
He took another sip.
TeU the truth, I even hate him. I hate him for all the things he hasn't done yet
but will do because 1 can't figure out how to stop him. Stop myself.
Himself, myself, the other Unwin, the No Win, the No One. Fm a supernumerary in
this universe, Fve violated the Conservation Laws. Not the laws of mass/energy
conservation, to be sure--with all the stuff that's constantly falling into and
out of black holes, one extra human body a little out of its time and place is
an insignificant, temporary statistical anomaly. The Conservation Laws Tve
violated are of a higher order; they are the laws of Psychic Conservation: there
shall be a constant ratio of Beings to Persons, one to one, per Universe. Extra
souls are forbidden, and where they occur shall undergo spontaneous decay.
And yet another sip. Rather more than a sip.
The night was only half gone. He'd better make this bottle last. Might last if
he got started walking now. The moon was bright, the clouds were all blown to
tatters. He knew the path down to the redwood valley; he remembered It very
well.
Small changes all very well, but not enough, not fast enough--got to make this
damned world work right, and fast*
Holder jammed the bottle inside his coat, cuddling it close to his tummy,
keeping it nice and warm. He struggled to his feet, pointed himself in the right
direction, and lurched off resolutely into the night forest
22
Above Seaton's head the twin rotors of the big cargo helicopter rhythmically
shredded the morning sunshine, spilling shards of light over his shoulders and
arms. His instruments, plus his practiced ear, reassured him that the copter's
supercooled magnets and miniaturized fusion-pak were feeding the blade-tip steam
jets with flawless efficiency. Through the clear plastic blister he watched the
landscape unfold ahead: it was an abrupt landscape, criss-crossed with lava
flows and ravines and dotted with cinder cones, all thickly covered with
trackless heterogeneous forest.
Suspended beneath the helicopter hi a cradle of polysteel mesh, swaying gently
in the breeze, lay 9,000 kilograms of sleeping Tyrannosaurus. The tranquilizing
cocktail administered to the animal back at Camp Owen Gorge was due to start
wearing off in fifteen minutes. Seaton planned to be on the ground in five
minutes, and off again in ten.
The communicator chimed. "We hear you down canyon, Frank," Alex's voice
announced. "Right on schedule."
"I'm starting my descent," Seaton said. He guided the chopper lower into the
wide canyon. Half a millennium earlier a great lava flow had stopped here, its
leading edge forming long fingers of high black volcanic rock. Between two of
these mesas was the chosen canyon, thick with oak and laurel and redwood. The
tallest trees dated from the earliest years of the terraforming of Bounty, and
grew to heights of over a hundred meters.
"Frank, you should be aware that we're missing Unwin,** said Alex. "I assigned
him to the base camp for the duration, but I just got a report he's turned up
absent"
114
RE-ENTRY
"Okay, Alex." Now Seaton could see the clearing, a patch of wet grass steaming
with mist in the morning Kght, ringed with bristling cycads and bright pink
clumps of rhododendron. Down through the trees he caught sight of one of the
observation cages, the one that Alex and young Phil were using, stationed in the
path the tyrannosaur was expected to take once ft woke up. Farther down the
canyon, along the same path, the Rangers had staked out a baby tops; the hapless
creature would provide breakfast for the half-starved carnosaur.
This early the ground mist was still thick, and Seaton hoped it wouldn't
interfere with young Phil's Holography; it meant a lot to the boy to do a good
job. The ground had been thoroughly soaked by the thunderstorms of the last
several days. Though the rain had caused the theropod expedition considerable
inconvenience, Seaton knew no one could do any-tiling about the weather--the
Central Environmental Council wouldn't allow it. Oh, they occasionally permitted
fine tuning of climate on a continental scale, but day to day tinkering with the
weather was a farmer's vice, a sure path to perdition.
The helicopter was clear of the trees now, flying below the tops of the tallest
of them. Downdrafts from the rotors caused the mist to curl up in great curving
festoons. Seaton circled the clearing slowly, his full concentration on the
dangerous task of landing the heavy machine. With no fossil fuels at all on
Darwin, and with clean fusion-paks notoriously cranky to maintain, a helicopter
was a rare and valuable piece of machinery--only two were assigned to Cretacia.
Below a hundred meters, with no forward airspeed, a power failure could be
disastrous: there would be no time to jettison the load and let autorotation
retard the fall.
But it was Seaton's job to deposit bis big baby with afl due delicacy, so he
came in slowly.
Kani alone of all the people knew that even at this moment a tyrannosaur was
among them. He had seen it descending from the sky in lazy splendor, and judging
by the sound of the sky machine when it went out of sight the creature must be
nearing the ground even now, and not too far away.
There were Rangers all around him, though--the place stank of them--so he must
proceed with extreme care.
Again the wicked thought tempted him: things were happening so fast, much faster
than the Trader said they would,
RE-ENTRY
115
and he was the only one to know, and the blood of Tyran-nosaurus was powerful
magic. If somehow he were to slay it before any of the others knew of its
existence, and make a personal thanks...
But the people would not thank him if he frightened off the Rangers before they
brought more tyrannosaurs, or if he frustrated the Traders' desires for hides.
Mother Ariana herself had given him his instructions: he was to learn the
details of the Rangers' plans, and plot the whereabouts of the new animals. He
was not to interfere in any way.
He really knew nothing about tyrannosaurs anyway, or how they behaved, except
what the old legends told. He badly needed to find out more. He moved stealthily
toward the distant sound of the sky machine's engines.
In die shadow of the deep woods the sound of the circling machine was muffled.
Fascinated, Holder watched the naked blond boy move among the misty redwoods.
The performance amazed him, partly because Holder was drunk, but partly because
it was a truly amazing performance.
Except for an occasional cycad, the eternal shade of the big trees prohibited
all but a thin ground cover of ferns and moss--nothing much to hide behind. The
boy depended only on silence, and a seemingly instinctive ability to pose
himself against the backdrop of tall ruddy columns and threads of mist and
shafts of pallid sunlight in such a way as to blend into the pattern of light
and dark. If one did not suspect his presence--and he had every right to assume
that no one did--he was as well hidden as the mosaic numbers in a color-blind
test are to the color-blind.
Holder utterly lacked the boy's skill at woodcraft, even when stone sober, but
he had the advantage of knowing where to wait before the boy had thought of
going there. As quietly as he could, Holder now moved to interpose himself
between the young "barbarian" and the deadly creature he stalked.
He intended to save that fool's neck. Nothing would change in the reality Holder
had grown up in, but as his mentor had continually drummed into him, Reality is
the reality where you are.
He wasn't doing it for the boy's sake, not altogether. His own worldline had
been a moving nexus of death, starting on that long-ago analogue of this very
day. Death was a function of his presence; he intended to reverse the sign of
116
RE-ENTRY
RE-ENTRY
127
the deadly function for the Phil Holder of this Reality-- therefore he was still
acting on behalf of himself, however that slippery concept was defined.
Under the chopper's belly the solenoids snapped the safety bolts back and the
shackles parted, allowing the metal net to collapse over the body of the
dinosaur. Instantly the fluttering shriek of the rotors changed pitch and the
chopper slid up and away, over the tree tops toward bare ground at the rim of
the nearest mesa. Seaton would park the craft overlooking the canyon until it
was clear he was no longer needed.
Rangers rushed through the ground fog to tug at the heavy netting that covered
the animal, pulling it away and spreading it flat on the ground. With quick
hammer blows of trenching tools they began pegging the edges of the net to the
ground, to keep the animal from tangling itself when it woke. They had only a
few minutes. The operation had been timed to minimize the period the tyrannosaur
would lie torpid on the ground, its heart and lungs straining against its own
crushing weight.
The last metal peg went home as the massive legs and tail quivered and the
ghastly jaws opened convulsively. The men and women scattered and ran for the
protective cages.
The Rangers had offered a baby triceratops to the tyrannosaur, Kani noted with
approval, even though its pitiful squeals made him uneasy. He circled the
chained animal at a distance,
Now he needed only to find an appropriate hiding place. Surely at any moment the
tyrannosaur would come this way, attracted by the staked prey. Kani took a
soundless step forward. The brush crackled in front of him. He froze.
Bright green fernlike fronds of redwood shoots, sprouting from a nurse log,
suddenly parted. A horrid old demon rose up pointing a weapon at him. "If you
know what this is, boy, you'll run for your life."
Phfl shuddered with excitement as redwood branches whipped aside and he found
himself staring down the pink throat of the tyrannosaur. He glanced at the
instruments on the recording gear that, along with himself, his father, and two
other Rangers, filled the observation cage to capacity. The recorder was getting
it all, a perfect pickup.
The giant bellowed and exploded from the trees, taking three frighteningly rapid
strides forward. The ground shook each time a clawed foot hit the ground. The
nightmare animal stopped briefly in the middle of the mossy little clearing, its
red expressionless eyes staring fixedly from under bony orbital ridges. Its
mouth hung open, and its breath came in liquid grunts.
"What a shot!" Phil exclaimed, forgetting himself.
"Silence!" Alex hissed angrily.
**Alex,** said Seaton's voice on the communicator.
"You could have picked a better time, Frank," Alex whispered. "What the hell is
it?" He didn't look at Frank's image in the communicator block, but kept bis
eyes trained upward through the bars at the dinosaur that towered over them.
"I can see Unwin from up here," Seaton said. "And somebody with him. They just
went past the little tops, running. If the rex dont stop..."
Thanks, Frank, well follow it up."
The tyrannosaur roared, and from the depths of the woods came the terrified
bleat of the captive triceratops calf. The tyrannosaur charged past the cage
into the shadows of the forest
Alex threw back the bolt on the cage door and shoved a rocket launcher into the
woman Ranger's hands. "Take the South wall, Shanta." He grabbed a dart gun from
the rack and thrust it at the man. "Em, you take the north. Dont wait for me,
Pll slow you down." He grabbed Shanta's wrist as she started through the door
and pointed at the launcher. "Safety off. Shoot to save Unwin's life, if you
have to. I'll take it out of his bide later." He left the cage behind them,
turning to slam the door shut just as Phil started to follow. "Stay in here,
PhU. Hear mer
Phfl stepped back into the cage, speechless with shame and fury. He watched his
father stump off down the path the carnosaur and the pursuing Rangers had taken.
Hell, he could take better care of himself than that half-crippled old man.
Dftmn him! And damn Unwin!
Unwin had done it again. He'd stolen the spotlight with Us insane antics....
Kani ran as fast as he could, making no effort to hide or I* silent Branches
whipped his face and bare chest as he ran.
118
RE-ENTRY
A dead bough scraped across him and yanked the rope from his shoulder--he flung
it aside lest it tangle him.
The shadowed woods behind him were howling with silent monsters. He could feel
the breath of hot-blooded dinosaurs on bis shoulders. He anticipated the searing
agony of a fire bolt from the demon's weapon at any moment, for now he credited
everything he'd ever heard of the demon Rangers. He did not look back. He simply
ran.
After many minutes of running he began to think perhaps he had managed to
outdistance his pursuers. He wondered if he dared slow down long enough to look;
despite his frank terror he was mightily curious.
He must have deeply offended the Goddess by merely toying with the notion of
disobedience, by just thinking of killing the tyrannosaur--as if he could
possibly have done sol Nevertheless, he did not question that he deserved death.
But possibly it was not her purpose to kill him; perhaps the demon had been sent
only to warn him away.
Ahead, where the valley widened and the north wall was always in sunlight, the
redwoods thinned and gave way to a grove of oaks. Kani left the shadow of the
evergreens and ran in among the twisting trunks. If anything had pursued him
this far he would have heard it now, crashing through the dead leaves thick on
the ground or shattering the brittle branches above. Yet he heard only his own
footsteps, and his sobbing breath. He slowed; he faltered to a standstill. He
turned, fearfully, and looked behind him.
He saw nothing. But he heard a drumming as of great wings, a thin unceasing
scream. The sky machine...
With mounting terror he felt the truth uncoil in him. They were coming from the
air. Even as he took a tentative step back toward the darkness of the big trees,
hoping to find sanctuary in the shadows, the old demon staggered out of the
ruddy gloom a dozen paces away. Red-faced and gasping, the old one hardly looked
formidable now. "Run, fool!" he screeched. "Don't you know what will happen to
you? What will happen to all of you? Run!"
Kani could barely decipher the harsh garbled words, but he turned. The aircraft
was louder, and coming closer. A woman black as all the Rangers emerged from the
forest a hundred paces to the south. She called something, something strident he
could not understand* and waved the long tube weapon in her hand.
RE-ENTRY
119
And now to the north another Ranger appeared, pointing a weapon and shouting
into the roar of the machine.
And overhead, through the limbs of the trees, the sky darkened with the shadow
of the flying machine, and a black face grimaced at him from the machine's
single eye, and the air was filled with the clatter and scream of vast
flickering wings. A great hot wind arose, blinding him with dust and summoning
uncounted dead oak leaves to dance a devil's mocking dance around him.
"O divine Goddess Mother Bounty take my soul," Kani cried, and fell trembling to
earth.
23
"Got a little problem here. Calls for strategy."
The computer said nothing. Langoza hadnt asked it a question yet. He drummed his
fingers on the arm of the pilot's seat, his swarthy face illuminated by the
green glow from the airplane's control console. Through the plane's windows he
could see the village hearthfires glowing deep within the shadows of the rocky
cleft, visible from the plane's parking place but hidden, even at night, from
the forest and sky above.
Langoza leaned back and rested his chin on the tips of his fingers. **Okay. This
kid the Mother sent out to spy on the Rangers got himself caught. Them two
warriors she sent to keep an eye on him, Meria, and Leri I think the guy's name
is, they brought her the news. They were real hot to go after the kid, set him
loose. She says no, whatever happens is destined or something. To me she says,
very sorry, looks like no rex hides for you, see you next year and thanks so
much for the beads." Langoza snorted. "No rex hides! Do you know what I can get
for a rex hide on Epsilon Eridani these days?**
"Yes," the computer said in its bland, machine-standard According to data
current at the time of our last
120
RE-ENTRY
RE-ENTRY
121
departure, on the Eridanian black market the uncured hide of a large
Tyrannosaurus rex is worth approximately 10,000 Eridanian cents. A cured
hide..."
"My point exactly." Langoza nodded. Then his features twisted, indignant. "So
who does this Mother think she is, telling me to take off?"
"Traditionally, the Mother Ariana regards herself, and is regarded by her
followers, as ..."
"Rhetorical," Langoza snapped. Idiot machine.
He got out of his chair, paced the few short steps to the back of the cabin,
then returned to the couch. "Okay. I've seen this coming for years. This
Mother's got some kind of fancy idea of doing away with us middlemen. That's one
good reason to get rid of her, right there. And her people are sitting right on
the territory I'm interested in most. That's an even better one. The question
is, what's the best way to do it?"
"In taking any action the first consideration must be to avoid bringing
suspicion on ourselves," said the computer.
"Brilliant," Langoza muttered.
"Therefore it would be advantageous to incite the Rangers to kill or capture all
of the Mother Ariana's people, but to do so for motives unrelated to Trader
activities."
'Terrific. Keep thinking."
"We have on board four cases of government issue rocket launchers, removed from
stores at Copeville."
Langoza's black eyebrows rose. What was his damned machine cooking up? "State of
the art, those are. Should he worth a pile to the rebels on Brindle. Didn't I
sure as hell pay that Ranger enough for "em?"
"Yes, You paid him 40,000 Darwinian cents. Recent rebel bids have been in die
200,000 cent range. Adjusting for overhead and expenses and current rates of
exchange..."
"Get to the point."
"Give one rocket launcher and a supply of unfused rockets to the warriors Leri
and Mera. Using the following arguments, induce them to attack the Ranger camp
on their own initiative ..."
"Hang on a second. Do that and the Rangers'11 wipe out the Mother's people,
okay, but they'll trace that gun right back to that Ranger, Sammy. Hell, they'll
think he sold 'em the gun!"
The computer had not been programmed to reply to truisms.
After a -moment Langoza got the point. "Okay. I guess it wont be too hard to
shut Sammy up before he spills. Tell me what I'm supposed to say to them fucking
savages...."
Holder was conscious of the stark moonlight, the black shapes of the trees, the
distant snort and shuffle of penned triceratops, the few stars bright enough to
shine in the moon-softened night He was also conscious of his own stink, and his
soiled* crumpled clothes, and the throbbing headache that marked the return of
sobriety.
Beside him he felt the looming taciturn presence of Mamaka, Alex's top wrangler.
A few meters away the entrance of the administration tent spilled blue light on
the moist earth. The fabric of the tent glowed a softer blue.
Holder registered all these things, but they suggested nothing to him. He had
been cut adrift in a universe of unpredictable phenomena..
Voices drifted to him from the tent, low, indistinct, soured with anger. Soon he
would be thrust into that vat of emotion, for the third tune that day. Meanwhile
he waited, without hope or plan for the future.

The Chief Ranger grasped the necklace of teeth in his thick dark fist and
jerked. The boy's head snapped forward, but the necklace did not break.
Shanta looked up from the monitoring instruments on the camp table hi front of
her. "Chief," she said, alarmed. "The record..."
Furious, Alex yanked again, harder. The leather thong parted. Teeth flew across
the tent, bouncing from the drum-tight walls, clattering on the plastic
flooring. Bright swells stood out on the back of the boy's neck.
In bis clenched fist Alex still held three of the curved teeth, each several
centimeters long. The necklace's broken thong hung limp. "Where did you get
these, you little bare-ass bastard?" His low voice was choked with temper. "Did
you kffl for them? Did you kill an animal so you could hang these
* around your pale primitive neck?" , The boy said nothing. He bad said nothing
during the last
�puion either, or the one before that. His eyes were downcast,
722
RE-ENTRY
his blond mustaches drooped, the muscles of his arms quivered with tension and
fatigue; he had not responded even when the Rangers had offered him food.
Shanta tried again. "Chief, I respectfully suggest.. .*' Alex swung around and
shook the fistful of teeth at her. "These are a gorgo's teeth. Five months to
grow a gorgo in the vats, and this son-of-a-bitch kills one to make himself
pretty." He glared at her. Her eyes dropped.
He shifted his gaze to Emerson, his laboratory chief. "Well, Em? YouVe got an
investment in this." But Emerson would not meet his eyes.
"He didn't kill no gorgo, Alex," said Seaton, matter-of-factly. Seaton was
stretched out in a camp chair by the entrance, his thumbs hooked in his trouser
pockets. "There's no gorgos around here. And that boy's not dressed for
traveling." "Then he killed something else to trade for them," Alex said
angrily. "A few tops, maybe. Ankylosaurs. Scolosaurs. Even a big croc. Scum
smugglers buy them all. He kiUs animals, Frank."
"Okay, Alex," said his friend, soothing him with his voice. "But the poor dumb
son-of-a-bitch doesn't know any better, you can tell just by looking at him." He
grinned ruefully to emphasize his point. "Now you know Cuvier's waiting on us,
Alex. When can I tell Re-ed we'll hand him over?"
"When he tells us where the rest of them are," the Chief Ranger said. "Frank, I
won't have that nice-folks-like-us shit you're peddling,"
"Don't shush me, Alex Holder, when I'm standing between you and a criminal
charge." Seaton sat up hi his chair. "This boy won't eat. He's dead on his feet,
but he won't close his eyes. I think he's beggin' somebody to kill him, Alex,
and it better not be one of us."
Alex jerked away from Seaton's blunt plain face. He didn't want to hear reason.
He pushed his own face close to the exhausted prisoner's. "You're lower than any
animal," he whispered. The spittle balled at the corners of his mouth. "I'll
find all of you people and clean you out of my country for good." He stepped
away, still glaring at the barbarian. 'Take him, Frank," he said at last "Lock
him up in the chopper."
Seaton stood. "Cuvier, Alex?"
'Tomorrow." Alex sounded defeated. "Call Re-ed, have them meet you at the Camp."
RE-ENTRY
123
Seaton looked at the prisoner, "Come here, kid." But the boy still looked at the
floor. Seaton stepped forward and gently took him by the upper arm. Passively,
the boy followed Seaton toward the entrance.
"Unwin again," Alex said.
Seaton pulled the tent flaps back to reveal Holder already standing there, his
face pale with doom--Mamaka had anticipated his Chiefs command. Seaton led the
naked boy past Holder, into the night
Holder entered, nudged by Mamaka. He squinted at the bright lights. Alex reached
out to Shanta's console and hit a switch with the flat of his palm.
"You can't do that, Chief," Shanta said nervously. "The time code will show the
lapse."
The batteries exploded," Alex said calmly. "You were burned and had to seek
medical attention. Emerson, you too."
Shanta and Emerson exchanged glances. Emerson's face twitched with indecision;
unlike Seaton, he had no experience talking back to his administrative
superiors. He half shrugged.
Shanta looked away from him, disgusted by his cowardice, though no less
frightened of Alex. "What about him?" she asked Alex, looking at Holder. "Did be
get hurt too?"
Alex stared at Holder. "I don't know yet. I think we just had a quiet chat while
you two were off getting bandages on your scrapes. When you came back the
equipment was working again and Mr. Whoever-he-is was making a full statement."
Shanta drew a breath, summoning her courage. "If that's not what happens, Chief,
I'm prepared to make a statement. A full and truthful statement Even if it means
my job. Even if it means yours."
"Thank you, Shanta," said Alex. "Go get that bump attended to."
"I'll be right outside," she said.
"Just get out."
She and the sheepish Emerson went quietly.
Alex jerked his chin at Mamaka and the guard shifted his grip on Holder; a
massive fist curled around each of Holder's elbows.
Alex stepped closer and lowered his voice. "Better be sober enough to talk,
mister, I want to find out what you're doing in my family. I want to find out
what you're doing with my
124
RE-ENTRY
boy. The rest I'll leave to Re-ed. But they'll never see you if you don't talk
to me."
Holder's fear crystalized--not because of Alex's threats, though he had no doubt
of the man's sincerity; plainly Alex had crossed that line where rage feeds on
self-justification. But the magnitude of what, in his drunkenness, he had taken
on himself stood suddenly revealed. What happened to the feral boy and his
people was now totally his responsibility. And Phil--in addition to everything
else, Phil would find himself embroiled in an inexplicable violation of the
Uniform Code, if Holder allowed anyone on Darwin to take his own genetic
profile, alive or dead.
Alex slapped him hard. **Come on, mister, you're running short of tune."
Holder's cheek stung and his eyes watered. On top of everything else, he had to
keep Alex out of trouble. For Phil's sake he had to come up with something that
would placate Alex, save face, and incidentally give himself time to plan an
escape.
**... what's the matter, are they unhappy with the way rm doing things? The new
Commissioners are a lot farther toward the edge than the old ones, aren't they,
Mamaka? But this character's too weak and disorganized to be anything like that,
too dumb, too soft to be a spy..."
"Not the kind you think," said Holder.
**... so who the hell are you?" Alex finished, before he heard the answer. "What
did you say?"
Why had he said that? What could he make of it? Not the truth, surely! "They
don't train professors in subversive techniques," Holder mumbled from a sore
mouth. "And not in self-discipline, either."
"You're a professor?**
No, after all, the truth was simply impossible. "I'm an anthropologist"
"An anthropologist!?" Alex's composure wobbled. "They went out with organized
religion!"
Holder attempted a grin. "No, that's missionaries." The grin hardened.
"Primitives get them confused."
Alex didn't move.
Holder knew his father well; he pressed the advantage. "Is it only non-
resistance that brings out the carnivore in you, Alex?" The more he tried to
make Alex lose his temper, the calmer Alex would behave, to spite him. Holder
felt per-
RE-ENTRY
125
versely powerful; how very simple it was to play on his father's anger! But it
was not a game to be played by anyone with anything to lose.
"Who are you? Where are you from?" Alex's dark face was darker with blood. "Are
you some kind of queer like that guy you pretended to be?"
"My name is Evan Bruneau," Holder said quickly, and so calmly he surprised
himself. "I'm an associate professor of anthropology at the University of
Epsilon Eridani. I have no intrinsic interest in your family, Ranger Holder."
**Keep talking, mister."
Holder twisted in Mamaka's grasp. "I'm tired, Alex. Can I sit down?"
Alex nodded; his glittering black eyes were iron studs in a wooden mask.
Mamaka stepped back and Holder sagged onto a camp chair. His head lolling, he
rubbed his neck with both hands. He began to speak. "I came to study the feral
people, the ones you call barbarians..."
**I call them squatters.**
"... like that boy you captured. But I couldn't do it legally. The government of
Darwin doesn't admit they exist." He tried to play it close to the truth, in
case he had to repeat himself. **I bribed Unwin to let me take his place--I knew
him slightly from the University, and I thought if I could get his job with his
credentials it might put me in a good position to contact the feral people. They
aren't all that much different from you, you know. I bet that boy's great-great-
grandparents were runaways from the soleri that stood where you live now. They
have a right..."
*They have no right to live anywhere,** said Alex.
"You're conservators, all of you, unwilling to let go of the past,** Holder said
bitterly. "You seek a mythic perfection, attempting to recreate something that's
dead and gone." Momentarily he was giddy with irony. He was repeating Words that
had been used to challenge his motives, to test his ,Wffl when he'd first sought
help on his mad quest. "Don't you Bod something faintly ridiculous, Alex, in the
notion of a ttme dinosaur?"
"lust talk."
More half-truths. "I was hoping I could befriend that lad [ tound wandering in
the woods, keep him out of your sight. |thought be might eventually lead me to
his tribe."
126
RE-ENTRY
RE-ENTRY
127
"Unhappily, you were drunk," Alex sneered. Clearly he knew the nature of the
temptation; perhaps he was overproud of his own ability to resist.
"Yes, I botched it. But then that's the story of my life."
"We were simply a vehicle for you, Professor? My son andir
"You were the vector. I was the disease.*1
"How well you put it." Alex reached out and nipped on the recording gear. "This
machine has been out of operation, on my orders,** he announced for the
holographic record. "Call back Shanta and Em, Mamaka."
Mamaka left the tent.
"To recapitulate our conversation of the last couple of minutes," Alex said
calmly, "you claim to be an anthropologist from the University of Epsilon
Eridani, by the name of ... again, please?"
"Bruneau. Evan Bruneau. B-R-U-N-E-A-U.** Holder was pleased; Alex seemed
convinced.
"Here to study illegal squatters, feral people' as you call them. For this
purpose, Professor Bruneau, you have seen fit to violate Darwinian law and the
administrative regulations of this district--gravely, and on numerous
occasions.*'
Shanta peered into the tent She entered quickly, sat at her console, and made a
few proprietary adjustments to the controls. Mamaka came in after her and stood
silently by the entrance.
Alex looked at Shanta. "Where's Em?"
"At the infirmary. He's literal-minded. His burns, scrapes, and bumps will be a
part of his permanent medical record."
Alex shook his head. He turned back to Holder. "Professor, you can make a
statement for the record if you'd like. If you've been mistreated, threatened,
that kind of thing...?"
Holder shook his head. What a simple man, for a man so complicated!
"You want to add anything to my summary?"
MI have a hunch I'll be repeating myself a lot, later on.**
"Oh, indeed," Alex said, with some malice. "If Epseridan confirms your story,
the diplomats will have a field day. Maybe Epseridan will decide you're not
worth the risk, Professor. Maybe they'll claim they never heard of you,"
Holder sighed. l(You may be right.**
Alex's dark smile expressed grim anticipation. "Want to change your story again,
Mr. Un... Professor Bruneau?"
For a moment Holder actually considered it, considered trying the whole truth--
that would certainly throw the Darwinian bureaucracy off the track for a few
days! If anything could.
But he could do himself no good, and do none for young Phil, by playing the
madman.
"No further statement, Ranger Holder."
24
"What's going to happen to him, Dad?" Phil sat on his bunk, looking past his
father at the empty bunk across the tent.
Alex seemed too edgy to. sit down, though pouches of fatigue showed beneath his
eyes. "We'll turn him over to Re-ed tomorrow. Don't worry about him. I didn't
come by to talk about him, really, I just wanted to make sure you were ... that
there was nothing you needed to tell me."
"About what, Dad?"
"Well, that man. He's acted pretty strangely the last couple of days, made a
public spectacle of himself. He didn't..." Alex straggled with the distasteful
subject. "He didn't act, uh, out of line with you, did he, son?"
"Well, no, I don't think so." Phil wasn't sure what his father was driving at.
"He always seemed unhappy about something. I mean, sometimes he made me feel I
was letting him down some way. But I think he liked me."
"How do you mean?" Alex asked. "Did he do anything?**
"No, really. He was just--he was honest"
"Honest!"
"*I mean, he told me what was on his mind, and he always knew what was on mine.
He was pretty funny sometimes, kidding me. And he was always pushing me, like he
had faith I could do things that I wasn't sure I could. Stuff like that i'just
felt he liked me." Phil wasn't sure his father was really Rearing what he was
trying to tell him.
128
RE-ENTRY
RE-ENTRY
129
"That's fine, then," Alex said, distracted. "I'll let you get some sleep* Phil."
He stepped back, pushing the tent flap aside.
"Wait a second, Dad," said Phil. "What about that other guy. The savage?"
ipWhat about him?" said Alex impatiently. "I've heard people talking." "Yes?"
Phil had been lying in the dark, and men and women too excited to sleep had
passed outside his tent, half whispering, unaware anyone was awake to hear them.
He had beard fear, and something else: an elliptical anticipation--of a hunt, of
a slaughter. The music of their words was evil.
When a Ranger wanted to express violent contempt, "savage** was second only to
"scum smuggler." Phil had never had to face the fact that savages were real
people. He didn't like to think what his father might do to real people who
acted the way savages were said to behave--killing precious animals.
"Nothing, Dad. Til see you in the morning." Alex paused, a moment. Something was
bothering Phil, that was obvious. But it didn't seem pressing, and other matters
were, "All right, Phil. Good night" Alex let the tent flap fall closed behind
him.
Phfl lay back on his bunk, turning his face to the wall. Pale blobs of blue,
refracted into four-pointed starbursts by the woven fabric of the tent, marked
the location in the night of other tents whose inhabitants would not sleep. The
administration tent was already dark, however. Tonight it was serving as a jail
Why had Unwin--whoever he really was--why had he concerned himself with savages?
How had he known the savage boy was out there in the valley? He must have known
it in advance; he could never have stumbled on a savage by accident
Who was Unwin? Unwin, who knew the ways of savages, though he claimed to know
nothing of this planet, this continent, even of dinosaurs.
Dad said he'd taken all that back, that now he claimed to be some kind of
scientist. But that sounded like just another tall tale.
Phil kicked at his cover and sat up again. When the chances of seeing Unwin
again had suddenly grow remote, something
had become clear: in spite of everything, the man was his friend. He had
questions for his friend, and very little time left to get answers.
His heart was pounding as he crawled the last damp meter OB muddy knees and
elbows. He reached out and touched the back wall of the admin tent His nails
skritched on the fabric. "Mr. Unwin? T.T.r
"Phil?** The hoarse whisper from the other side of the thin wall was barely
audible. "What are you doing here?"
**I wanted to talk to you before they took you away." Phil put his mouth close
to the walL "Did they inject you with a tracer, T.T.T'
"No, Phil." Unwin's whisper sounded almost amused. "I dont think they were
planning on taking prisoners when we came up here."
"�Since they didn't..." Phil paused tentatively. "Would you like to get out of
there?"
**Yes," came the answer, quick and intense. .    **Move away from the wall. I'll
slit the..."
**No!" Unwin's voice rose above a whisper, then dropped back. "There's a charge
on the mesh. Don't perturb the field --I set it off once already tonight.'*
"Can you tell if Mamaka's awake?**
"He*s asleep, I think. But I'm taped to the tent rib. If I pull away m break
it."
*TD kffl the power and cut you loose." "Can you get past him?"
"Sure. It's hard to wake him up when he's really asleep. Wait** V
Phfl crawled along the side of the tent until he reached the .front Cautiously
he poked his head around the corner.
In front of bun was the open field m the center of the encampment a once-grassy
meadow plowed into muddy chaos b   the feet of humans and dinosaurs. Tents
ringed the field, of them dark. At each end of the field a hooded lamp on a tall
standard, burning with a directionless white tke big cargo helicopter was parked
under the nearer its long blades drooping, its polished aluminum skin ng the
lights.
Though shadows moved in some of the tents, no one was the field. Phil wriggled
around the comer to the entrance the administration tent, and paused long enough
to listen
130
RE-ENTRY
RE-ENTRY
131
to Mamaka's even, natural breathing. Cautiously he lifted the flap, revealing
Mamaka's muddy boot, heel on the floor, toe in the air.
Phil pulled himself into the tent, sidling around the boots, inching forward
until he estimated he was in the middle of the floor. He raised himself to his
hands and knees and crawled slowly toward the back of the tent, feeling bis way
around chairs and table legs, gingerly lifting his bare knees over dusty
electrical cables taped in bunches to the floor.
Under one table he found the wire he was looking for, felt along it up to a tiny
generator set on the edge of the table, fumbled for the tab on the face of the
device until he was sure he had the right switch, and killed the alarm.
By now his eyes were accustomed to the darkness. He could make out Unwin sitting
with his knees drawn up, his ankles taped together, and his bands pulled behind
him tightly where he was fastened to the tent upright. He was bound as securely
as any dangerous prisoner.
Silently Phil felt for the tape on Unwin*s ankles, then quickly sliced it away
with his pocket knife. He moved closer, feeling behind Unwin for the knot of
tape at his wrists. He could smell a rancid, fruity odor of sweat and old
liquor, and he could hear Unwin's wheezing breath. He held his own breath while
he cautiously sawed at the sticky tape.
Finally it was cut through. For a moment Unwin didn't move; then, painfully, he
rolled forward onto his hands and knees, and crept after Phil.
They didn't stand fully upright until they reached the shelter of the
eucalyptuses. Still they had to move cautiously--the way was choked with myriad
slender eucalyptus shoots standing straight up, forming a labyrinth of vertical
bars. Leathery sickle-shaped leaves and acorn-sized nuts covered the soggy
ground. -Finally they found a small dark clearing deep in the woods, and sat
Unwin shuddered. "Thanks, Phil." He paused. "You wanted to talk? I guess I owe
you."
"Who are you?"
"You do come to the point." His voice was choked. "Fm not really anybody, Phil.
I can't tell you any more than that"
Phil knew he would never get the answers to all his questions. Perhaps Unwin
couldn't answer them; but he wanted something for his efforts. "What's going to
happen to the savages? Do you know?"
"Not really. But Alex wouldn't deliberately kill anyone."
"Do you believe what they're saying? That if the savages fight back..."
'1 don't want to." Unwin rubbed bis wrists mechanically.
"You always told me the truth, T.T."
"Leave it, Phil. I can't read the future. Not any more."
They were silent. The stars glistened cold and remote; the eucalyptus smell was
bitter in the chill air.
Unwin broke the silence. "And there are no savages, Phil. Only savage acts."
"I didn't mean..."
"I know you didnt. But I want you to remember that, if you forget everything
else."
"You came here to save those, uh, feral people. Didn't you?"
Unwin was quiet a very long time. When he finally spoke it had nothing to do
with the question he'd been asked. "I've enjoyed the tune we've had, Philip
Holder. With luck you'll grow up to be a good man, God, I wish..."
"What, T.T.r*
"Nothing. You'll be a good man, Phil, I know it.w
Unwin's expression of that thought made Phil queasy. Abruptly he got to his
feet. He startled something small and mammalian in the darkness; he heard a
furtive rattle and scurry in the leaves.
"Tune you got some sleep," Unwin said for him. *Thanks for the furlough."
"Sure. Goodbye, T.T." Phil looked at him huddled hi the darkness. What would
become of him? He turned nervously and walked away. He took only a few steps
before he stopped and turned again. "T.T.?"
"Yeah, Phil?"
"Good luck. Thanks.**
"Do me a favor, Phil. Try to forget I ever existed."
Phil was torn between staying to comfort the mysteriously desolate man and the
knowledge that he had nothing to offer him. He walked away.
Barely had Phil's head touched his pillow when the night
erupted.
The roof of his tent lit with diffuse orange light, and he heard shouting--first
one man, then two, then a woman's
232
RE-ENTRY
RE-ENTRY
133
harsh challenge. Then the triceratops started bellowing, drowning everyone else.
He poked his head out of the tent flap, but he could see nothing clearly, only
intermittent flares of red light illuminating the trees beyond the field. A bolt
from a firegun blossomed beside the mounted floodlight near the helicopter, but
did no damage.
The shouts and flares suddenly quieted, and only the belligerent trumpeting of
the animals continued.
Phil turned and fished around on the floor of the tent for the shorts he had so
recently shucked off. He pulled them back on and thrust his bare feet into his
boots, then stumbled out of the tent.
Frank Seaton was striding toward him. Phil stopped in his tracks. What was Frank
doing here? Catching sight of him, Frank beckoned with a jerk of his thumb.
"Let's go, PhiL Your Dad wants a word with you.*'
25
The helicopter bounded smoothly from the dewy ground, beating upward through a
broken layer of fluffy cumulus into a clear eastern sky. Soon the Ranger
encampment was far below. The silver machine was alone above the clouds with the
great purple cone of Owen; beyond the mountain the rising heraldic sun hurled
rays of golden light through the tenuous clouds of morning.
Seaton piloted the copter hi silent concentration, helmeted and visored against
the dazzling light. Beside him in the right seat Phil sat brooding, stunned by
the series of events that had put him here.
He had been prepared to take full responsibility for freeing Unwin, even knowing
that the odds against a lone man in the wilderness were poor. He hadn't been
prepared for Unwin to steal Mamaka's gun and free the savage. So many bolts were
fired last night, so many tents went up in flames, it was a miracle no one was
killed. But the only injury was to a wrangler who'd sprained her ankle dodging
an excited tops. The way Frank had reconstructed the scene, Unwin had tried to
create a diversion to cover the boy's escape and his own, but only the boy had
made it
Nothing could have prepared Phil for the full force of his father's anger. Ales
had never struck him before; the angry red print of his open hand still burned
on Phil's cheek, palpable in imagination, if not visible. And the words...
Tears gathered, and Phi! would have let them come if Seaton had not been so cold
and armored and far away hi the seat beside him. Phil stared at the cloud-
clotted landscape below, forcing the raw memories back. He would show no
emotion. He would save it for later.
But one thing he would not let go of; he sucked on ft, nursing his resentment
against Alex: nothing justified Alex's hatred of the savage boy. A dead animal
could be reconstructed, if not revived; nothing could replace a dead human. And
nothing would resurrect a son's dead respect
Phfl leaned forward in his seat "Frank, what's that?"
A thin track of white smoke was rising swiftly out of the dawn-shadowed forest.
In an instant it had pierced the hazy cloud deck and now bent toward them in a
wide smooth arc. Differential speed made the tracer smoke slide rapidly against
the background of jungle and mist
Seaton must have seen the thing even before Phil, for his reaction was too fast
for thought Already he'd pushed the control yoke hard over, and Phil suddenly
found himself hanging sideways from his crash harness, staring straight down
over Seaton's shoulder at the trees far below. For the briefest moment the
helicopter wobbled under the unbalanced pull of vertically spinning rotors. Then
it started to fall.
Phil felt the climbing missile strike, a single brutal punch from a giant rivet
gun, high in the center of the fuselage.
"We're alivel" he yelled, surprised and triumphant as if it were a game and he'd
just scored a point "It didn't explode!"
Seaton, less assured of his immortality, said nothing. The instrument panel
flashed crimson, the forward rotor vibrated badly, and a loud shriek announced
the escape of liquid helium and high-pressure steam from the coiled metal
entrails of the stricken craft Seaton slapped switches, opening
134
RE-ENTRY
RE-ENTRY
135
the safety valves in the steam lines, disengaging the rotors, shutting down the
magnets that contained the tiny fusion reaction.
The helicopter righted itself with a jerk, hanging suspended under two
counterrotating, free-wheeling rotors. Flying as an autogyro in this inherently
stable configuration, it rapidly gained forward speed. But it could not long
remain aloft; each meter gained in range cost as much in altitude.
"Get on the com. Tell them we're going down," said Seaton. "And get your damned
helmet on." His eyes never left the twisted landscape rising so rapidly to meet
the damaged machine, which feU now as freely as a winged seed on the wind.
Leri and Meria stared in awe at the glittering speck fluttering down out of the
heavens, skywriting its own obituary hi billowing clouds of white vapor. Finally
the sky machine disappeared from their view below the surrounding canopy of
trees.
The portable rocket launcher, hardly bigger than a rifle, rested gingerly hi
Meria's hands. She held it away from her body, partly because the tube was still
hot from the booster cartridge, partly because the thing frightened and
disturbed her.
Leri looked at her. "A powerful weapon," he said, swallowing.
"Langoza told the truth in that," she replied. . "You think he didn't tell the
truth in everything?"
Meria looked at him angrily.
He looked away from her, shrugging as if to adjust his rope. "Let's find the
wreckage. Then we'll know."
Phil's nerves were extra-fine-tuned, and his sense of time was slowed. He
watched the whole spectacle unfold hi front of his as if he were watching an
adventure sensie.
He savored it. He almost laughed with the pleasure of it, skimming down fast
over the ridges, dodging the grasping treetops, neatly threading the winding
arroyo--what wonderful skill Frank showed, how buoyant and responsive the
powerless helicopter feltl
All the while he was calling on the communicator (not paying close attention,
really, the view from the bubble was so thrilling): "Mayday, Mayday, this is
Ranger Two, we're shot and we're going down, we're about forty klicks east-
southeast of your position and going down real fast.. .**
The rocky little beach was right there in front of them, how well Frank had done
it, what flying! And then a treetop came up and got in the way and there was a
belt of a smash and he was jerked and bounced and pulled all around and leaves
and branches were whipping at the bubble and it was squeaking and scraping and
then it exploded jesus right in his face and something slapped him hard all over
oh god oh god worse than Alex it stung all over his face his arms his legs ohhh
SHIT!
They weren't moving anymore. "Shit, shit, shit, shit, SHIT!" he screamed, make
the awful burning go away--he was on fire as if bitten all over by ants. He
ground his teeth until they threatened to splinter in his head.
Curiously, that helped. Slowly the hurts, the thousand cuts and scrapes, all
began to blend and mellow and throb together in one low purple heavy hot ache.
He'd lost his helmet. It must have popped off over his head on the first bounce,
for there were cuts all over his face. He brushed his fingers lightly over his
cheeks and came away with a thin film of sweat and blood. On the back of his
hand he could see the intricate tracery of threadlike welts. He'd been lashed
hard, but not badly sliced up.
Beside him Frank sat up quite straight, his helmet still in place, apparently
unperturbed by the scourging branches.
"That was great, Frank!" Phil yelled, loud in the silence. **God, I was such a
baby, screaming like that, I'm sorry, I guess it just took me by surprise, I
thought we were going to make it to the beach, but you were terrific anyway,
just a few more meters .. .'*
Frank sat very straight, and didn't move, and said nothing.
Phil shut up. He went cold.
Then the hurt came back from inside, in a blunt bitter rush against his eyes and
throat
There was a hole in the roof, and green light filtered through to fill the metal
box like an aquarium. Something warm and salty dripped onto Holder's cheek and
ran into his mouth. He recognized the metallic flavor of blood. He wasn't
worried, though. Scalp wound, probably--dramatic, but not serious. Worst it could
do was bleed all over your eyes....
He tried to sit up straight. The world was all askew. What the hell was going
on? This damned airplane or whatever
136
RE-ENTRY
RE-ENTRY
137
seemed to be tipped right over on its side, and whafs more it didn't seem to be
going anywhere at all. Was this a doorway under his feet? All smashed in with a
tangle of splintered tree limbs and a thick mat of spicy-smelling leaves, smells
like bay laurel, like that restaurant, that little Italian or Greek place,
whatever it was, back on Parnassus. Made him homesick for his adopted planet;
the food there had character! Damn but he was hungry, so damned hungry.
Should move soon. Didn't like that whistling sound, it was getting real loud or
maybe he was just noticing it and the pitch was driving him crazy, like his wife
shrieking at him, you goddamned bastard you don't care about anybody but
yourself why don't you wipe that long-suffering smirk off your face, and he
screamed right back at her, all right go ahead then, go on the damned liner by
yourself and be damned and take the little bastard with you; and it made him
want to shut her up for good.
The screeching faltered.
Have to stay rational. Don't let her pervert your reason. Except when she hits
you, digs those long nails in, by god nobody can be expected to sit still for
that smash her just throw her out of the way...
"Where am I?" he demanded, shouting to stay conscious. "Please get me out!"
He listened for a moment: nothing but a hiss now, you goddamned bastard you
don't care about anybody, and then a scrape and a sob,
"Yes, Tm here, can you get me out?" Holder cried.
A face peered in at the ceiling, a face all scratched and bloody, with a big
purple bruise blooming along one cheek. T.T.r A boy's voice.
Holder stared back, puzzled. "Can you get me out of here?" he asked eagerly. "My
head... my head is cut. And I think my hands..." He tried to get a look at his
hands behind his back, but he couldn't get his chin over his shoulder. *They
feel like they're stuck together."
The boy was crying. "Frank's dead, T.T. t tried to wake him up. I couldn't find
his heartbeat."
"I'm a doctor. If you get me to him,.."
"And then I saw where... where it went through him. He's dead, T.T."
"My name is Holder, I'm a doctor..."
Then he remembered. He remembered being taped up for the second time that night
and tossed into the chopper's cargo hold like a sack of turnips; he remembered
dawn and the start of the flight, the lurch and fall, the shock of the striking
missile above bis head, the sickening spiral down out of the sky. He remembered
a glimpse of branches whipping past outside the open door, fleeing past all
blurred, and then nothing.
He stared up at the face in the opening over his head, the far door. The face
was Phil's. "Frank's dead?" he asked. The boy nodded.
He'd saved that wild boy, an right Now Frank. There was meaning in this fearful
symmetry....
Phil scrambled through the roof of the chopper. His legs dangled a moment, then
he dropped the two meters onto the springy broken branches poking through the
opposite door, Phil quickly looked Holder over, pushing with his thumb at the
man's head wound. "That'll be okay when I get some *plast on it," he said.
Apparently they'd taken his knife, for he looked around and then started
worrying a jagged piece of the chopper's torn aluminum skin back and forth until
a plate-sized slice of it came off in his hands. He took the makeshift cleaver
and sawed away at the adhesive tape that bound Holder's hands behind him. "I'm
getting good at this," he muttered.
Holder kneeled, holding his hands out behind him, staring at the canted bulkhead
in front of him--wondering what to say. How he'd loved Frank Seaton ...
"Crying won't help us, T.T." Phil finished cutting Holder free.
Holder looked at the boy, saw the tear streaks still wet, freshly superimposed
on a net of dried blood. But Phil spoke sternly, as if he'd forgotten all that.
"Somebody shot us down on purpose. They can't be far away. We have to get away
from the wreck."
"Who would want... T
"Scum smuggler, probably. I called base, but I don't know whether they heard us.
The com is busted, and I don't know whether the beacon is working or not. It
would take them half a day to get the other chopper up from Copeville anyway."
"Are you sure you're all in one piece?"
*Tm fine. Come on."
138
RE-ENTRY
"What about Frank's ... ?"
"I thought about it," Phil said angrily. "We'll have to come back."
Holder rose slowly, steadying himself with one hand against the panel overhead.
He rubbed his wrists and flexed his knees. "I guess I'm in one piece."
"Good." Phil chinned himself on the overhead door and clambered onto the side of
the wreck. He bent to give Holder a hand up. With a grunt and a scuffle Holder
managed to pull himself out. He stood shakily and looked around.
The helicopter was in three pieces. The fuselage had broken behind the cockpit;
it was cushioned on a smashed laurel, its belly resting against an outcropping
of lichened basalt. Ruptured steam lines hissed with waning conviction as
pressure bled away.
Twenty meters up the steep hillside the tail rotor mount and the stub ends of
the rotor hung in a shaggy juniper.
The nose and forward rotor mount were down the hill. A shattered tree trunk
protruded into the remains of the blister. Frank's torn hand was just visible
through shards of plastic, thrown back against the cockpit bulkhead. Holder
quickly looked away.
Down through the trees Holder could see a sunny clearing, a beach of water-worn
stones in the angle of a wide rushing stream. Dizzily, Holder closed his eyes
and then half fell, half jumped off the wreck.
It was a long fall. He landed heavily on the dry, gravelly slope, rolled out of
control, and came up hard against an oak stump. He gasped.
He heard a thud and felt a sharp spray of grit against his cheek. "Don't do a
stupid thing like that again, T.T." Phil's voice was harsh. "I can't get us out
of here if you break your leg or something."
Holder opened his eyes and looked at this boy whose face was a mask of pain,
anger, and concern--the boy who wanted to save his life, when all he wanted to do
now was die.
"Follow me. Be careful." Phil slid and scrambled down the steep slope toward the
stream. Holder followed with dull caution.
They paused at the water's edge to wash and drink deeply. The water was cold,
fresh, insistently rushing. The morning sun was bright and warm, though the
forest air was still cooL Holder looked up at the steep wooded ridges on either
side of
RE-ENTRY
139
the river. Even this close there was no sign of the wreckage; it would be
visible only from the air--or to someone who knew where to look.
"Where are we going?" he asked Phil.
"This stream leads into another, and eventually to the Gorge. From the air it
was plain as a map, until we got below the ridges. Here, look at me." He patched
Holder's wound with a glob of sterile 'plast, talking as he worked. "We're not
far from the base camp by air, but I don't think we should try that way--way too
rough. There, that should fix you. We'll have to go down to the Gorge and then
home."
"That will take days. What will we eat?"
"Well do okay, T.T. Haven't you ever tried roast tops eggs?" Phil looked at him
oddly. Holder thought maybe it was an attempted smile, to cheer him up. "And I
saved these," Phil said, tapping the emergency ration kits he'd clipped to his
belt--from the helicopter's survival gear, each could keep a person alive for
several days.
Holder grunted, weary of protest He sat down on a rock and stared at the smooth
pebbles between his shoes.
Phil sat on another boulder and unlaced his boots. "Looks more passable on the
other side,** he said. He tied the laces together and hung the boots around his
neck. He stood and waded into the swift current
Holder lifted his weary head and looked at the boy. The sun sparkled on the
rushing waters and glittered on the leaves of the trees beyond.
Fumbling with his boot laces, he copied Phil's actions. The pebbles were sun-
warm on his bare feet but the water shocked him with cold. He walked into the
stream until he was standing in the middle of it, with water swirling around his
waist and his bare feet digging into fine gravel that boiled up between bis
toes. He had trouble standing against the current, and he had to clench his jaw
until he got used to the cold ache in his ankles.
This was the first time either of them had ever stepped into this river. What
sort of waters were these, that tugged them this way and that, and said, come
with us?
26
The wooden spade's last load of earth fell on the mound covering the Ranger's
body. Ariana stepped forward and took from her daughter a delicate bowl of
incised red clay, decorated with an intricate geometric pattern in gleaming
black. She sprinkled the mound with a dark mixture from the bowl. "Blood and
meal feed you as you feed us, blessed," the Mother said quietly. "Rest for a
cycle of cycles. Bring forth bounty on our return."
Kani stood apart from the crowd, watching her. Behind her loomed the dark mouth
of the grotto. A ray of sunlight filtered through the trees to pick out her hair
of straw, hair of wheat--to Kani she was the incarnation of Bounty.
She handed the empty bowl to her daughter, the Successor. Her glance swept the
silent bitter crowd of villagers, who stood .with their belongings bundled,
already prepared to march. Kani thrilled with fear when her eyes met his.
She spoke firmly, her voice amplified by the rock arch behind her. "The call
comes late, die call comes early. This cycle has been short So be it. In a
season or two even these rich gardens would have cried for rest. Rejoice with me
that the Goddess has taken no son of the people."
Behind Kani he heard his uncle mutter spitefully, "Kani was called, but would
not answer."
The Mother looked directly at the man. "Kani was spared by the Goddess herself.
In the cycle of cycles the world changes; she has sent us this Ranger for her
thanks. A mortal man, like any man of the people." The Mother turned away from
the grave and walked slowly away, dismissing them all, cutting off protest
before it could be expressed.
When they realized the ceremony was over most of the people shouldered their
bundles and began moving quietly away. A group of men lingered near Kani. Again
he heard
140
RE-ENTRY
141
his uncle's voice. "Next time let the Goddess spare a man with a house and a
garden and a wife."

"A man who is a man," added another, "who won't crawl back to us stripped of his
initiation."
Kani would not look at them. He kept his eyes on the fresh grave. He wanted to
protest that he had submitted himself completely to the will of the Goddess,
that he had given her his life. But she would not take it. The same irascible
old demon had come to him where he lay bound and had hissed curses at him and
hauled and shoved him and then had started throwing bolts of flame hi every
direction--convincing Kani that the Goddess must surely have intended him for a
more dignified death at some later time.
For a night and a day he had made his way through the forest, reaching the
village in the ravine at dusk. He found Langoza's machine gone, the people
hastily packing, and Leri and Meria standing guard over a man's body. He
recognized the dead man as the pilot of the sky machine, the one who had
captured him, the one who had later been kind to bun, and had saved him from the
wrath of the other Rangers. Kani could not fathom the motives of the Rangers,
but be felt a kinship with this one, who was dead in his place.
He stooped and took up a pinch of earth and sprinkled it on the grave.
"See what poor thanks..." his uncle began, taunting.
"Leave us, Kareli," said a woman's voice.
Kani looked up in fear. The warrior Meria and her brother stood in the cave,
watching him. They had killed the Ranger. He'd heard that they had brought down
the sky machine with some powerful weapon. What did they want with him?
He heard the men behind him scuttle away in fear.
Leri stepped toward him. "You were dead," he said. He and his sister had an
almost furtive look about them. "You were dead and your body was in the sky
machine, the Trader said."
KanTs fear left him, but he didn't know how to answer them.
**We shot at the machine to recover your husk. For the flianks," the woman
insisted. "We would not have killed this creature except for you."
That made Kani angry. "You want to blame what you did on me?" he said bitterly.
"Go ahead then. All the village blames me."
142
RE-ENTRY
"No, Kani, we are the ones to blame. For listening to the Trader," said LerL
"The Mother orders us to seek your forgiveness."*
"Both of us seek your forgiveness," the woman said stiffly.
"Ask his forgiveness," Kani said defiantly, and immediately he regretted his
defiance. But the warriors made no move or sound. "Of course I forgive you," he
amended. And still they did not move. "Should I say more?" he asked cautiously.
Leri cleared his throat. "The Mother said you would... oh..."
"You would teach us a lesson," Meria finished for him.
The boy looked at the two adults who stood before him like chastened children,
and wondered what he could possibly teach them that they did not know better
than he. "Maybe she means about the Rangers," he said quietly. "The 'demon
Rangers.' They try to act like demons, maybe, but I think they are people like
us." He looked at the grave of the one named Seaton. "You call him a creature.
He, at least, was a man; that I know.*'
From the shrine, now denuded of its paltry relic, Ariana watched the people file
out of the ravine below. She had not dared risk infecting them with panic, so
she had' said nothing of her convictions.
She was sure that the days of the people were near an end. Whether in a few days
they would all be dead, or whether instead they would be carried into captivity,
her people would no longer be free to roam the forest and to till their gardens.
The world would change indeed, but not as Ariana had hoped; Langoza had seen to
that
Never before had the people fcflled a Ranger. She knew the Rangers would not
forgive them.
She heard the steady thump of distant sky machines. She turned to look toward
the east, and there, over the purple shoulder of the Mountain of Vapors, her
far-seeing eyes picked out the little silver bangles hanging in the sky--three,
four, six, eight of them. Never had she seen so many.
And there could be no mistake, they were coming straight on.
27
Yesterday afternoon they had been laughing together, stumbling along, giddy with
fatigue, kept on their feet by the knowledge that they were no more than a day's
walk from the great falls at the mouth of the Gorge. Then the sun went out. When
they looked up, they saw what had been a blue sky suddenly boiling with clouds.
A strong fragrant wind descended the gorge, whipping ferns and palms, churning
the swift green river to froth. Blown red sand scoured their skin, forcing then1
eyes shut
Phfl groped for Holder and got a fistful of his shirt sleeve, and desperately
pulled him up the slippery slope.
Lightning bolts, wide, bright and terrible, exploded on the rimrock. A few fat
raindrops blasted craters in the sand, but even before the rain came down hard
the flood was upon them, not a wall of water but a fast-sliding jumble of
chocolate milk, tossing logs and boulders before it
Straight up they climbed, and kept on climbing, while the muddy water lapped at
their boots. They found a narrow ledge, and a crevice in the rock to hook their
fingers in. All night they clung to the cliff, even when the roaring winds and
waters finally faltered and gurgled away, and the stars came out directly above.
They had time to talk and remember, then. They tried rehearsing the epic tale of
then- descent through the canyon, choosing which episodes to treat heroically
(the Charge of the Bull Triceratops) and which to treat comically (Stealing the
Egg-stealer's Eggs). Holder didn't bother to remind Phil that he personally
wouldn't be around for the telling of the tale. That wasn't the point of the
exercise, anyway. The point was to keep talking, so they wouldn't fall off the
cliff while dreaming drowsily of solid ground.
The gray predawn light revealed their predicament: overhead the wall kept on
going straight up for a hundred meters.
143
144
RE-ENTRY
Below, the drop was sheer, ten meters or more, ending in a pile of broken
basalt. To fall was to fracture a leg, or more probably a neck. But the light
was no help to them in locating the finger- and toe-holds they'd found by feel
in the semi-darkness, which somehow no amount of stretching and groping could
find again.
They discussed their predicament, and very sensibly agreed they could not
possibly go up, and could not possibly go down, and could not possibly cling to
the cliff for more than a few hours. It was an opportune moment for a rescue
party to happen along up the Gorge trail.
They knew there would be no rescue. They had seen no searching aircraft, had
seen no aircraft at all after the squadron of helicopters that had passed over
to the south on the day after the crash, and those helicopters had been on no
errand of mercy. Alex must be searching in the wrong place.
Holder longed for the wings of a pteranodon. They had seen them clustered by the
dozens, hanging from caves in the cliff faces like enormous bats, or wheeling
and gliding on the rising currents of the afternoon.
A centipede appeared from somewhere below and undulated up the rock, climbing
right over Holder's hand. Holder did not flinch; he admired and envied the
multiply surefooted creature as it rippled upward out of his sight.
Now Holder watched Phil. As he studied the boy's face, despair and determination
warred in him. He had changed Phil's life, and for the better; he could see the
evidence of it in front of him. But they would take him away from Phil, even if
both of them survived.
They had stopped talking an hour ago; nevertheless Holder knew what went on
behind the boy's eyes--the process was visible. A meter or so out from the base
of the cliff the river swirled, thick with brown silt. No points or edges of
stone broke the surface, no upwelling currents betrayed hidden presences; still,
the opaque fluid could mask anything.
The dilemma was simple. Jump now, and face the likelihood of a long and
agonizing death, lying broken and half drowned in shallow water. Or fall later.
Only in the first choice was there any hope of life at all.
But to make that one rational decision called on resources . beyond mere reason.
Under Holder's absorbed gaze, Phfl--his racing heart visible in the vein that
throbbed on his forehead --reached that decision. He jumped.
RE-ENTRY
145
In panic, Holder jumped after him. He would not be left alone.
They disappeared under the water. The pool was deep, unobstructed. When they
bobbed up again the naked fear was on both their faces. Perhaps later they would
laugh about it Not now.
From the center of the broad brown stream Claymore and Sirich watched the
distant jungle slide slowly away on either side. Palms drooped under the hot
sun; crocodOes and hadrosaurs peered dully at the passing airboat. The air was
thick with humidity from last night's storm. Though the craft moved sedately
ahead, the breeze of its passage was warmly cloying.
Following Holder to Camp Owen Gorge had proved to be easy. He had done just what
Sirich, and Unwin for that matter, had said he would. But the Camp was off
limits to tourists, so beyond Waterhouse Claymore had been prepared to take to
the jungle at night on all fours, face blackened and knife hi hand, hi the worst
old sensie tradition.
In talking over the situation with Sirich, a simpler approach had suggested
itself. An anonymous call to the Chief Ranger, wfth a few choice details about
the private life of his son's tutor (selected from the real Unwin's history),
might be enough by itself to dislodge Holder from the protection of die camp.
She'd placed the call (sound only, her voice hoarsely pseudo-disguised). Alex
Holder had neatly trapped her: under pretext of demanding evidence, he'd asked
her to describe the man she was talking about She'd given him a description of
Holder.
Moments after she switched off, the innkeeper arrived at the door of her room
accompanied by an unsmiling Ranger. The Ranger stayed with her, until the
airboat arrived, several hours later, to fetch her to the Camp.
At least she was heading in the right direction...
She looked away from the hazy riverbank, glanced specula-tively at Sirich, and
found Sirich looking at her with a little smile, as if to say, No, Angelica--7
could have tripped you up so many times before, if that's what Td had in mind.
Even the unspoken thought satisfied Claymore. Aloud, she said, "I need your
advice, Clarissa."
Sirich was ready to give it "Have you considered the
146
RE-ENTRY
truth? Alex is a blunt, stolid fellow, if I remember him correctly, but he's not
without imagination. He'll be shocked, but he'll also be eager enough to give
you Holder--without a word to anyone about it."
"You want me to convince a responsible official on Darwin that reverse time
travel is real?" Claymore was scandalized. "My mission is to preserve the status
quo."
Sirich's face wrinkled in an impish grin. "You're a much worse conservative than
anyone on Darwin, Angelica."
Claymore looked away. She saw nothing to smile about; it was her own status she
sought to preserve. Who was she-- who was anyone--to take on the burden of all
history, to manipulate and adjust here and there, to try to improve things.
Either things must remain as they were and would become, or Claymore would
become responsible for everything in her past and future--for the anonymous
personality-deaths of her father and mother, for the System that had crushed
them, for all the good and evil in the universe.
The hot wind brought tears to her eyes.
Holder and Phil, tattered and hungry, reached the base of the Cataracts as
Persephone rose in the west. To Holder's eyes the evening star was a luminous
blessing in the purple twilight. The spray and thunder of the falls was all
around them, softening the outlines of the scattered mossy blocks that were the
only remains of the ancient soleri that had spanned the mouth of the Gorge. The
man and the boy sat in the shadow of the cliff, exhausted by their climb.
Holder looked at Phil and saw a scrawny, toughened youth, newly self-confident.
Phil had brought them through alive. He was a different boy than he had been, a
different boy than Holder had been. Was it enough of a difference to make a
difference? Some ungenerous, niggling reluctance to let Phil be, now that he had
begun to exhibit competence, would not allow Holder to admit he had as yet
accomplished his aims.
They were home now. The camp itself was out of sight behind thrusting cliffs,
but its warm lights were liquidly reflected from meandering ripples in the broad
shining stream. There was another light on the river, moving--an airboat, by the
sound--coming around the bend a kilometer downstream. Seeing the boat, Holder
thought of Frank.
"They'll be happy to see us," said Phil.
RE-ENTRY
147
Holder said nothing. Camp Owen Gorge, young Philip Holder's home, was no home to
him.
"I'm sorry, T.T., I didn't think," Phil said. "Where will you
gor
'Til find some smuggler and bribe him to take me off planet," Holder said,
though the truth was that he intended to find a way to stay behind, to keep
watch over Phil somehow.
"You'll never make it to Copeville on your own. Wait for me hi the trees--later
I'll get some food to you, maybe even the coder to the boat. They don't bother
to guard it up here."
"Phil, you can't keep involving yourself in my escapes. Alex will..."
"I'll do what's right, no matter what Dad does to me."
"Okay," said Holder, placating him. "I guess it would be pretty stupid of me to
tell you to be careful, after what.,."
?Just shut up, T.T." Phil reached out and grabbed him around the shoulders and
hugged him close.
Holder steeled himself against the nausea he knew would come. When it didn't, he
tentatively put his own arm over Phil's shoulder and gave him a cautious pat
They released each other and wearily struggled to their feet. They walked in
silence down the broad path to the Camp.
Away across the lush lawns, black in the deepening evening, they could see
yellow lights in the house. Shadows
moved inside.
A stand of monkey puzzle at the base of the cliffs marked the dividing line
between the wilderness and the anomalous spot of civilization that was the camp;
the conifers were dark, thick, more ancient than dinosaurs. Their prickly
tentacle-like branches rubbed gently together in the cool breeze from the gorge.
"You'll be safe here," Phil said.
"All right, Phil. Don't rush things, okay? You've got all night."
Phil nodded and turned away. Holder let him get a few steps ahead before he
began to follow, his own footsteps muffled in the thick grass.
Phil never looked back. He skipped a step, and then he began to run. Soon he was
out of sight in the shadows under the trees at the front of the house.
Holder was close enough to see into the house now. Alex and Isabel were clearly
visible inside the kitchen, illuminated
248
RE-ENTRY
as if on a tiny stage. Alex was sitting at the kitchen table, looking down.
Isabel crossed the room toward him, said something inaudible, and then looked
away. Absently she reached out to stroke the back of his neck with a cool hand.
Holder realized with a start that Alex was crying. He'd never seen his father
cry; the sight unsettled him. Big wet tears overflowed Alex's red eyes and made
his cheeks gleam. Every few seconds he pushed the tears away with his blunt,
spatulate fingers, but still they came. With bis left hand he nibbed his
forehead as if it ached, but in fact he was trying to hide his face from his
wife.
Every child has shared Tom Sawyer's dream of revenge, imagining his own funeral
with grim pleasure. Holder found no sweetness in this intrusion on his parents'
grief, but a different greed held him: he realized, with only perfunctory shame,
that he was actually jealous of Phil for the joy of the reunion ahead.
Isabel heard a noise hi the front of the house, and with a word to Alex she went
to investigate. Holder knew it was Phil. He stood transfixed.
Then, at the bottom of the lawn, he saw the red and green running lights of the
airboat as it pulled up to the dock. He saw three shadowy figures start to climb
out, silhouetted against the faint afterglow on the river. One he recognized:
Mamaka.
Reluctantly he backed away from the house, deeper into the shadows. He regained
the shelter of the auracarias and found a nest beneath the trees, a dry patch
prickly with the fallen, scale-like needles. Cold and hunger helped him fight
off sleep, but not for long. He was giddy with fatigue. He slept dreamlessly.
He woke. The wind sighed and the branches of the monkey puzzle creaked. He was
very cold now, colder than at any time since the trek from the wrecked
helicopter had begun.
A dark figure stood over him.
"Phiir he asked softly.
"No, Philip. Clarissa Sirich. You must come with me right away.**
28
He let the airboat drift a kilometer downstream before cutting in the engine. He
drove all night at top speed, depending on the imaging radar for help in
following the Marsh's broad curves. Once he almost hit a swimming cory-thosaur.
By the time the western sky was softening with dawn he was ten kilometers below
Copeville. He steered the boat in among the cypresses, threading his way slowly
between silent gray sentinels until he felt the pontoons scrape bottom. He
abandoned the boat and waded half a kilometer to dry land, moving cautiously to
avoid quicksand.
He slept all day under flowering rhododendrons.
Alex switched off the communicator and looked at the old woman who stood across
from him in the darkened study.
"Do you understand why I wanted to talk to you privately, Ranger Holder?" the
woman asked.
MI don't understand anything, but I know how to follow orders. They said to give
you what you want, to do what you said, and not to ask questions."
"Good. I want you to appear to search for the man who called himself Unwin, but
I don't want you to find him. And I don't want you to give any indication to my
companion that you are not doing your utmost."
"Who is that man?" Alex said angrily, disobeying the orders he'd just agreed to
follow.
The old woman looked at him sympathetically, but she spoke with firmness. "You
will never know. I will tell you only that he had the best of intentions toward
you and your son, and that he has done you no harm."
Alex, who was a good soldier to the depths of his soul, swallowed his rebellious
reply. He turned away and began organizing the phony pursuit.
149
150
RE-ENTRY
Late in the afternoon Holder started hiking back toward Copeville. Whenever he
heard a bushbuggy he hid. He reached Whitney's just after dark.
He sat at the far end of the counter, where he could watch Whitney, the
customers, and any new arrivals as they stepped onto the porch. He ordered a
bottle of Palm and a plate of Whitney's enchiladas. Whitney cooked them himself;
they were surprisingly delicious. Holder gobbled them down hungrily.    s
He paid for the meal, but when Whitney handed him back the credit blank he
didn't take it. Instead he suggested that Whitney record an additional hundred
cents or so on his personal meter, and give some thought to the problem Holder
would now describe to him....
It was almost midnight when a black-bearded man in a flashy plastic suit
sauntered in. He looked vaguely familiar to Holder, although Holder could not
place him. Whitney had a few words with the man at his table, then crooked his
finger at Holder. Stiffly, Holder got down from the stool he'd occupied for
three hours. He approached the man's table.
"Mr. Whitney has expounded your problems to me, Mr. Unwin," the man. said. "If
you can negotiate, oh, say three times the commercial first class rate, I think
I can help you."
"I've got credit."
"You want to sit down?"
Holder shook his head.
"Have it your way. I run a little tour business, but at the moment things are
kind of--up in the air. Thought I'd take a little recreational run to Epsilon
Eridani. That suit you?"
"That will be fine."
"Terrific. Let's see the color of your plastic, Unwin. By the way, my name's
Langoza..."
"What is it this time, Jim?" See tossed her long black hair and stared
impatiently at the communicator on her desk.
"I'm sorry, See, but this one is really strange--now she wants us to clear an
Earth ship to land at Cuvier Port, something called a 'Sprint.'"
"Do it. What's so strange about that? Did you think she got here in a time
machine or something?"
"I didn't finish, See. She wants the clearance filed now, but the ship won't get
here for another ten years..."
RE-ENTRY
151
They flew to Cuvier in Langoza's lander, which--like many hi its expensive class--
doubled as the command module of his yatch, the Cormorant. Langoza's legitimate
tour business gave him a convenient cover, and when he chose he could dress as
conservatively as any moderately successful small businessman, although his
speech pattern betrayed him as a man who'd spent time in lompocs.
Holder played to Langoza's self-esteem and contempt for the straight world. He
portrayed himself as one of those know-it-alls, ivory tower types who were
really no better than any lush. The role fit Holder well.
In Cuvier they picked up two crew members, a taciturn woman named Marthe who was
to be their pilot to Epsilon Eridani, and a teen-aged crewman, Jorge, who had a
permanent sniffle Holder easily diagnosed as a symptom of olkane addiction.
Langoza made Holder put on a white uniform too, and gave him a set of slivers
identifying him as a member of Cormorant's crew. The forgeries were terrible;
Holder had no choice but to assume Langoza had placed enough bribes to insure
they would never be closely inspected.
They proceeded to the orbital port, where they hooked up the living-module and
mass tanks Langoza kept berthed there. With the ship now in intersteller mode,
they obtained a clearance for Darwin Station and set out to lock onto the
Epseridan beam. It would take them several days to align with the beam, and
thereafter a little over a month to reach the holes, under constant half-gee
acceleration.
Holder spent those weeks giving the rest of his money away.
"Dealer's choice, Mr. Unwin." Langoza smirked at him; he enjoyed winning.
Holder peered blearily at the deck in front of them. A sly smile crept over his
features. "Ever heard of 'baseball,' Cap'n Langoza?''
Langoza grinned wider. "A very exciting game."
Marthe and Jorge exchanged amused glances; they had ferried some prize ostriches
aboard Cormorant, but this fellow Unwin bid fair to top them all.
"Okay. Nickel ante," said Holder, going for broke. The pot in the center lit to
record his five cents, and quickly increased to twenty as the others paid.
Holder had less than a hundred cents remaining in his stake, but the other
player's table
152
RE-ENTRY
squares all glowed with the green that indicated four figures plus.
Holder took a long sip of his drink, a big bulb of colorless liquid. Then he
clumsily shuffled the cards, real old-fashioned rectangles of printed cardboard.
He'd cleverly insisted that Langoza break a fresh pack before the game, but by
now he'd managed to mangle them thoroughly. Jorge, on his right, cut the deck;
then Holder dealt, sending the cards slithering across the tabletop in the half-
gee acceleration.
"Whoa, Mr. Unwin,*1 Langoza protested, fumbling with his hand. "Some of us ain't
quite so adept as you, you know."
Holder looked at him craftily. "So you'd like me to think, Captain."
Langoza's eyes widened in innocence, while his shipmates stifled their laughter.
The three of them had thoroughly fleeced their passenger when the game was
straightforward five card stud; now, hi a desperate attempt to turn the tide in
his favor, the drunken Unwin had proposed a game so full of wild cards it could
hardly be called poker--thus multiplying then- chances to cheat The crew fully
expected this to be the last hand of the night, if not of the whole voyage.
Holder thought so too.
His fumbling fingers flew, dealing cards in every direction --he had to grab at
one to keep it from falling into Jorge's lap, and hi so doing he knocked the
boy's beer bulb into his lap.
They both grabbed for it Holder clumsily knocked it under the table, and it took
him an awkard moment to catch it and haul it back to the surface. He grinned
sheepishly.
With mock suspicion Langoza suggested they should check to see that Mr. Unwin
had no extra aces up his sleeve.
"I'm sorry, really I am," Holder said very sincerely, and was rewarded with a
contemptuous grin from Langoza.
Jorge took a sip of the foaming liquid, licked his lips, and sipped again. He
sniffled.
The players studied their cards. Langoza had the strongest hand showing, a queen
and a wild card, a nine. The boy bad a pair of fives. The woman had an
apparently worthless miscellany, but when her turn came she bet five cents
anyway. Holder guessed it was mere protocol, a prior agreement with her
shipmates to help jack up the pot
On "the strength of a single nine showing Holder raised a
RE-ENTRY
153
dime. On the second round the woman folded, Langoza met and raised. The boy
sniffled. Without excusing herself the woman got up and began climbing the
handholds set in the far wall, up to the lender's cockpit.
"Come on, Jorge, you going to play or not?" Langoza prodded the boy, eager for
the kill; clearly he had cards in his hand to back up the strength that showed.
Jorge opened his mouth, yawned, yawned wider. His fingers relaxed and the cards
slid out of his hand; his head lolled back on his shoulders and he stared open-
eyed at the light on the ceiling bulkhead.
"Something's wrong, Captain!" Holder exclaimed, sounding frightened. He stood
up, dropping bis cards, simultaneously getting an arm under the boy's arm and
across his chest, and puffing the limp body across his own. With his free hand
he yanked the boy's pistol from its hip holster. "Don't call her or 111 have to
shoot you both," he said to Langoza, holding the weapon steady and aiming it at
his astonished face. "Now come here and take a slug of this beer. It won't hurt
you. But HI kill you if you don't."
Langoza raised his hands, but didn't move. "You fuckin' son of a bitch," he
said, with something Tike admiration.
Holder allowed the crewman's inert body to crumple to erne side, never taking
bis eyes from Langoza. He caught up the bulb of beer and suddenly threw it at
Langoza.
Langoza grabbed it reflexively.
"Drink it," Holder snapped. He was taking a chance on the smuggler's jaundiced
view of the world: any man who could outsmart him would probably be willing to
kill him.
Langoza eyed the liquid, weighing his chances to escape. Apparently he concluded
they weren't good. He drank.
�That's plenty," Holder said.
Langoza looked at him balefully, opened his mouth to say something, and then a
vaguely worried look came over his distinguished features, his knees wobbled,
and he fell slowly toward the floor.
Holder bounded across the short space between them and caught the fatal bulb of
beer before it hit the padded floor. He let momentum carry him to the far side
of the cabin. He peered up the ladder toward the control deck. The woman
couldn't be up there long; there was really nothing for a pilot to do once a
ship was locked on the beam. � Then he saw her foot descending toward the first
rung.
154
RE-ENTRY
RE-ENTRY
155
He pushed himself back to the other side of the room to give himself an extra
second. When at last her head and hands appeared below the hatch, he spoke.
"Change of plans, Marthe. Let me buy you a drink."
An ordinary medicine chest, such as may be found in any soleri apartment or
spaceship lavatory, becomes a veritable pharmacopeia of useful poisons to an
experienced epidemiologist in need. With the means in hand, most of Holder's
energy had gone into creating an opportunity to use it.
He spent a few extra minutes packing as many contraband dinosaur hides into the
escape capsule as he could fit on top of the three sleeping occupants. He sealed
the hatch, made his way up to the cockpit, and settled into the command couch.
He reached over his head, flipped off a safety cover, and depressed the trigger
that jettisoned the lifeboat. On the screen he could see it dropping away
behind. Within a few ; days Customs would track it down by its automatic
squawker, Holder didn't really care what the Rangers did with Langoza and his
accomplices after that, but he hoped they might take the hint of the stolen
skins.
He spoke to the control computer: "Cormorant, I have a problem for you.. .**
The Lorentz transformations are precise, and the passage \ of half a millennium
had taken nothing from their usefulness. Solutions appeared on the instrument
display, changing constantly as the yacht continued to accelerate. Holder stared
at the equations, watching the symbols cascade past in a stream of light, while
his hand rested heavily on the chrome lever that would execute the course
change,
The mathematical problem, the simple problem, had been solved. Other problems
remained,
"My God, Clarissa, did you follow me here? Why? How did you find me?"
"No time, Philip. You are pursued by a dire opponent."
She led me to the boat, showed me the code sliver in the lock and the clothes
from my room and the food from stores. Phil's work, she claimed, but she said
he'd been called away before he could rouse me. For his sake I had to be gone
before he tried again, she said.
Again I asked her where she came by her omniscience,
but she ignored me. "You now," she demanded. "Where will you go?"
I saw no reason to hide the truth from the woman who had made all my efforts
possible. "I'll hide in Copeville. I've got plenty of credit left, I should be
able to hire a structural makeover. Somehow I'll get back- here and finish the
job I started."
"No, Phil, you can't take that risk now. Claymore knows everything, and the
Darwin authorities are on her side. She'll track you in no time -- your only
chance is to get off-planet immediately."
And she told me what to do. She'd cover for me as long OS she could, she said.
"What's in it for you?" I asked her. "Why do you even care?"
"We'll meet again. Then Til tell you everything, I promise."
were many things he would never find out if he didn't take the next step. His
hand tightened on the lever and he pushed it home.
Verniers pulsed. A low warning tone buzzed. "Off the Epsilon Eridani beam," the
navigation screen announced, in bright red letters.
"Cormorant, override the beam warning."
The warning buzzer fell silent and the blinking red light went off. Holder
sighed and drummed his fingers on the arm of the control couch, unconsciously
mimicking the ship's former owner.
He was committed now; he was heading into the future. Would it be any
improvement over the past he was leaving behind?
Stage Three: Darwin and environs, 186 N.E.
29
The woman whose friends called her See rubbed her fingers over her weary face
and turned away from the Special Projects computer display. She felt
tantalizingly close to answers she had been seeking for almost too many years to
count, but even her eternally restored body could become bone weary if she
insisted on mistreating it.
Better to put aside her private studies until she could resume them with her
full attention; one virtue she possessed above all others was patience. The
delegation from Earth was due to arrive in two days. It was essential that she
devote all her time to the delicate diplomatic chores ahead.
Another appointment was imminent, although See had not discussed it with anyone.
Ten years ago she had watched herself--indubitably herself, Clarissa Sirich,
although disguised as a woman forty or more years older--confidently giving
mysterious orders and making mysterious arrangements, the purpose of which had
never been revealed. See had never questioned her alter ego, but she was
convinced that when she returned, something of profound significance would be
unveiled, that her self-restraint would be rewarded.
At the very least she might learn the secret of travel back in time, sometimes
discussed by her scientific comrades as a theoretical possibility, but never
with enough interest or conviction to result in an actual attempt. Or would to
learn the method from her time-traveling self constitute an impossible paradox?
Patience! There were more immediate and pressing matters to attend to. Still, it
piqued her curiosity that the landing cleaarnce Asmussen had granted a decade
ago, on her orders to the strange Earth ship, the Sprint, was now to coincide so
exactly with the arrival of Richard Ruiz from Earth. In a universe of
possibilities, interesting coincidences were inevitable. But was this one of
them?
159
160
RE-ENTRY
RE-ENTRY
161
Dawn reddened the underbellies of the clouds as the multi-wheeled tour cruiser
rolled to a stop on the crest of a grassy rise. Soon the sun would rise above
the cloud deck and the color would drain from the landscape, leaving only the
wan yellow of the prairie grass, the hazy blue and white of the Lyell Mountains
fifty kilometers away, and the sodden gray of the low clouds themselves.
But for a time the world shimmered with light, reflected from numberless ponds
and bogs and from the lazy curves of the Agassiz River. Tundra grass and
wildflowers were silhouetted against the * shining water, like inkstrokes on
copper.
The occupants of the cruiser had been traveling for half the night, en route
from the Administrative Headquarters for Pleistocenia, near Cuvier. The
passengers included Clarissa Sirich, Senior Research Scientist at the Institute
for Biological Research in Cuvier, and her distinguished guest from Earth,
Richard Ruiz, Speaker of the House of Representatives of the United States of
North America.
The Speaker was an early riser, and he thought he would be the first of the
cruiser's passengers to reach the observation lounge in the morning. But Sirich
was there ahead of him. As he sat down she smiled and nodded.
Ruiz's helot--the only person he expected to be up before him--moved quickly up
the aisle from the galley, bringing a cup of coffee. Ruiz held the coffee
gingerly away from his delicate Hps with a slight grimace: still too hot! This
new helot was a slow learner. He glanced over at Sirich. He knew Darwinians
disapproved the use of helots; though he would not hypocritically do without his
servants on a state visit, he did refrain from taking disciplinary action in
front of Sirich.
"I've got them," said Alex Holder, who was driving the cruiser. He had been
perusing the landscape with field glasses from the vantage of the forward dome
ever since bringing the vehicle to a stop. He turned toward the passengers.
"Your side, Mr. Speaker. Inside that bend in the river, about ten kilometers
off."
Ruiz bent forward in his armchair, pressing his face as close to the curved
window as dignity would allow. The moving figures in the distance were little
better than tiny black specks. He heard a commotion behind him, and turned to
see his associate Macklin's puffy face pushing clumsily
through the door from the sleeping area. Ruiz actively despised the pop-eyed,
freckle-faced Representative from Colorado, and he was furious that the House
had elevated such a crude arm-twister to a position of responsibility. But Ruiz
was too shrewd a politician to make waves until he'd arranged matters a little
more to his liking. Then he'd get rid of the jerk for good.
"Macklin, you bring those glasses?" Ruiz asked irritably, as if addressing a
helot
"Wha... ? Ob, just a moment, Richard. I'll get them." Macklin started to
withdraw.
But Sirich leaned across the aisle. 'Take mine, Mr. Speaker. Fve seen this sort
of thing often."
"Why thank you,      Dr.   Sirich."   A   perfectly charming
. woman, Ruiz thought. And certainly a much more important
figure in Darwin's Central Council than she pretends to be.
Ruiz adjusted the collagen contacts of the little glasses as Macklin came
forward to take a seat. The view outside snapped into focus, excitingly close: a
band of perhaps a dozen skin-clad hunters had isolated one of the largest of a
herd of mammoths. The other hairy beasts were lumbering off north across the Ice
Age landscape in a fast loping shuffle, their knobby heads and small ears thrust
well forward as they fled the predators. But the chosen victim, an old animal
with silvery gray streaks in its brown wool, was being driven slowly and
inevitably toward the cliff-like river bank.
"Most impressive!" said Ruiz enthusiastically. He seemed glued to the glasses,
which hummed quietly, stabilized by a tiny high-speed flywheel. "You say they've
been following the herd for several days?"
"We've been tracking the hunters for about three days now," said Alex. "That's
how we figured they'd probably make the kill early this morning.**
"Well worth the trip," said Ruiz. "I'm even more pleased we concluded our
business early, Dr. Sirich, so we could have time for this."
"How long's this exhibit been on display?" Macklin asked, yawning. He had curled
up in the seat behind Ruiz, paying little attention to what was going on
outside.
.This is the first group from Cretacia," said Alex to Sirich. "TTie Ariana
people."
"Yes. Thank you, Ranger Holder. In that case, gentlemen," she said to Macklin
and Ruiz, "this group would have been
162
RE-ENTRY
in the field, oh--allowing for a couple of years of on-site training--about four
or five years. Generally we'll want to observe them for at least a year to make
sure they're conforming to known cultural parameters in the absence of direct
supervision, before we allow visitors." She added casually, "In fact, Mr.
Speaker, that would make you the first non-Darwinian to observe this particular
group."
"Well, I consider that an honor," said Ruiz. "I mean it"
"You're very kind," said Sirich.
Ruiz watched the scene in rapt fascination. Nowhere on Earth could one see
anything to compare with the scope and primitive grandeur of the scene. After a
moment he said, "Perhaps the most amazing thing is that these people haven't
been altered in any way. Is that correct, Dr. Sirich?"
"Not physically altered. In this case even the fair appearance--the pale skin,
yellow hair, and so on--is quite natural. As far as we can tell these people are
descendants of a small group of Darwin's original settlers--settlers of Bounty,
that is--whose own ancestors were Scandinavians on Earth. Coin-cidentally, that
makes them physically ideal for this sort of environment. But beyond mere
considerations of historical accuracy, our extensive research has so far
suggested no method of adjusting human neural systems without impairing vital
survival mechanisms. These effects may be less obvious in a civilized setting,"
she said, in reference to the practice of brainburning, so widespread on Earth,
"but I'm sure you can understand why the members of a tribe of hunter-gatherers
need to keep all their wits about them."
"Yet somehow you've trained these people to live like barbarians," Macklin said
flatly.
"In more than one way their life now is a good deal less barbaric than before
they were reeducated," Sirich said.
"That's true," Alex Holder put in. "These people and their ancestors led a
furtive existence for centuries, hiding in caves, living off nuts and berries
and sweet potatoes. Finally we caught them and rounded them up. We like to think
we did them a service."
"Thank you, Alex," Sirich said, retaking firm control of the narrative. 'This
group and many others like them underwent a long and intensive indoctrination
into contemporary life on Darwin ..."
"You call it 'indoctrination'?" Macklin interrupted. "Not
RE-ENTRY
163
'brainburning'?" His tone insinuated the distinction was purely semantic.
"Not anything like brainburning," Sirich patiently affirmed, "just simple
instruction. And after that period we gave them a straightforward choice."
"Choice of what?" Ruiz asked, not taking his eyes from the glasses. By now the
hunters had driven the mammoth well into the gooseneck of land embraced by the
river's swift but shallow current. The line of hunters stretched from shore to
shore across the tiny peninsula. The mammoth had become aware that he was
trapped.
"A choice of whether to join the mainstream of Darwinian society, or be trained
further for life in Pleistocenia. In the case of this group, almost all the men
and perhaps a quarter of the women chose to become hunters. Of those remaining,
all of the women and most of the men have adapted well to New Era civilization."
"Remarkable," Ruiz murmured, intending a compliment.
"What about your other so-called 'evolutionary epochs,* Doctor?" Macklin asked,
in that needling tone of his. "How do you get consenting adults to play ape-man
a couple of million years lower down on the scale, huh?"
"We don't." Sirich paused briefly, then went on as calmly as before. "Our
research has only recently begun to delve directly into questions of human
evolution, Mr. Macklin, We have not thought it appropriate to create hominids
other than homo sap."
The mammoth had turned now, and faced his tormentors.
"Okay, but these people here," said Macklin. "I suppose these pretend savages
can always change their minds if they get tired of the Stone Age?"
"No," Sirich said coolly. "We gave them a year in the field to commit
themselves. We made it clear there would be no contact with civilization after
that. In fact, that's why we won't go any closer this morning."
"And if they get sick or injured?" Macklin fairly crowed. "If the game is
scarce? If they're snowed in?"
"They die."
Ruiz's grip on the glasses faltered, but he'd heard her correctly. They
definitely did things differently here on Darwin, where an intact mind was
valued more highly than life itself. His gaze was drawn back to the life-and-
death drama on the distant plain.
164
RE-ENTRY
"Nature is harsh," he heard the woman say to Macklin, as he continued to watch.
"Our purpose here is to recreate the natural history of Earth in every
appropriate detail. We believe it's important to preserve a living record of the
home-world of the human race, even though our real home has long been
considerably--altered." Ruiz watched the blond hunters launch a wave of spears at
the cornered mammoth: their wrists snapped forward at the last instant,
propelling flint-tipped projectiles from short atlatls with stunning force.
The tiny stabilizer of Ruiz's glasses hummed. Inside the comfortably warm lounge
of the tour cruiser the ventilation system whispered. Ruiz held the little
glasses lightly with the fingers of one hand while he reached for the coffee
he'd set down on the bar tray in front of his couch--it was cool enough to drink
now.
In the view from the glasses the mammoth screamed fearfully, silently. A half
dozen spears hung from its bloody flanks. The terribly wounded animal staggered
backwards and, seemingly in slow motion, fell from the high bank of the river,
collapsing heavily onto the gray sand beach below. Though he struggled still,
plainly one of the creature's legs had broken with the impact of the fall. The
hunters raced to the edge of the cliff to peer down at their prey, which would
provide them with meat and bone and ivory and leather and wool for months to
come.
"Mr. Speaker, Dr. Sirich, sorry to break in," said Alex. "But if we're going to
get you back to Cuvier in time, we'd better think about leaving."
"Can't the plane pick us up here?*' said Macklin petulantly.
"Policy forbids unscheduled overflights anywhere on Darwin," said Sirich. "I'm
sorry, but I'm not m a position to bend the rules."
Ruiz finally tore his gaze from the spectacle outside. "Don't fret, Doctor,
you've been most kind." He leaned over the arm of his chair and returned her
glasses. He gave her a long grateful look from his fine dark eyes. Then he
turned to Macklin. "Get that helot to bring me some more coffee. Drinkable, this
time."
30
"O Pili, Pili, how can you be so good?" Her crooning voice was as high and thin
as a ten-year-old's. "You always forgive me ..." She clutched his chest with a
curled hand, all fingers, like a baby's fist clutching the breast. Outside their
bedroom the sky was turning pale, and a thousand birds chirped and twittered.
Phil took her by the shoulders, tried to pull her close. "Damn it, Maya..."
(groaning, not angry; he'd been in hell for over a year and the ache never went
away) "... I'd never go anywhere without you, you know that--"
Her eyes seemed to film over. "You want to leave, I know it." Abruptly she
pulled away from him, rolling out of the bed and onto her feet. She looked back
at him over a bare bony shoulder, her eyes now full of strangely flirtatious
hatred. "Don't try to change your mind now, you bastard. It's a little late to
say you're sorry."
He sat up. Had it been another trap? Had she trapped him again so easily? "You
damn little bitch." In that moment he bated himself more than he hated her.
She savored the obscenity; her eyes lit with triumph--it was so sweet when he
lost control. She leaned toward him, her hands hooked, snatching at his face. He
flinched, raising an arm to cover his eyes.
She cowered away as if terrified, screaming "No! Don't touch me!" in a raw high-
pitched screech that set his teeth on edge. She wheeled, and her claws swooped
down on the crib and caught up their son, startling him from his drowse, his
pursed mouth wetly smacking as the pacifier fell away.
Phil struggled to his feet, trying to be alert and ready, though his head buzzed
with distraction.
"Don't touch mel Don't you dare touch this baby!" Her lips were pulled back in a
gorgon's mask; she held the wriggling discomfited child out in front of her with
both hands
165
166
RE-ENTRY
as she staggered backwards into the comer of the little apartment, seized with
an ecstasy of self-dramatization.
He knew his only recourse was to stand there numb as a post, audience and
supporting cast of whatever production she had chosen to stage this morning, his
only comfort the hope that if he kept his place today's scenario might not
require the services of the neighbors or the police.
He stared at her pale distorted features, waiting for whatever would come next.
He thought of the other times ...
In the beginning, when he still thought the arguments were about something,
something specific, he'd tried reason. She twisted each word, using it only to
pump her fury higher. He redoubled his efforts to be rational; her hysteria
increased logarithmically. Once she actually threw the child at him, changing
her mind an instant too late, and Phil had been hicky to catch him--he thought
his throat would burst with the pounding of his heart.
The next time (a week later? a day?) he thought he saw it coming again, and he
tried to snatch the child away first. She'd clung to him as desperately as the
false mother before the judgment of Solomon, confident she could defeat Phil by
her willingness to see the baby's arm torn off before letting
go-He tried silence. He wouldn't talk to her when she started; if it got too bad
he simply turned and left the apartment. Her shrieks and curses would follow him
onto the street. But when the "accidental" fires began, he never dared leave her
again, without her leave ...
"Phil you bastard, listen to me! You can't stand there pretending you don't hear
me--**
Her pinched harrowing features swam briefly into focus in the morning light.
Then they receded into some bright sharp comer of his mind, while with the rest
of his consciousness he went on mulling the impossible predicament. He realized
quite clearly that she was screaming at him, that she'd already struck him once,
twice, hard enough to draw blood--so hard she'd apparently twisted her hand. He
felt her pain, and his own. But he was unmoved. He heard her words, but he was
untouched.
He saw her hatred turn to puzzlement, her spite" become mixed with fear. Did he
think he could frustrate her perform-
RE-ENTRY
167
ance--did he?--by the simple expedient of being present without being here? She'd
show him something new, then. And when she had, she'd leave for Epsilon Eridani
without him, just her and the baby.
He noted her remarks. He noted that some part of his mind objected strenuously,
that some part of him owed love and protection to the baby, indeed to both of
them, and that some part of his body yearned to move, to reach out, to block her
exit. He noted all these feelings with great interest, and he did nothing.
She dressed and packed quickly. She screamed at him to help her carry the heavy
bags. When he still did nothing die cursed him at length, while efficiently
unpacking and repacking the essentials. Hoisting the wailing baby onto one hip,
she slung a plastic satchel of the child's things over one shoulder, reaching
for the remaining suitcase with her free hand.
But she paused before picking it up, straightened, looked at him with a face as
pale as a banshee's. She stalked into the kitchen alcove. With one practiced
hand she jammed the recycler open with a fork from the sterilizer, then shoved a
length of tablecloth into the orifice--all the while clutching the child to her
hip with her other arm--until black smoke started pouring from the chute.
Back to the sitting room now; as Phil watched he could read her thoughts on her
face: a quick look around, smash two pictures, pull over the book shelf (leap
back! Just in time--watch, don't let the baby overbalance you, he's bawling so
loud now he can't catch his breath), hurl the heaviest lamp at the window (only
cracked, not smashed through, shit), then grab the heavy bag and with careless
superhuman strength lift it off the floor.
Out through the door, out through the crowd of gawking half-clothed titillated
neighbors, out of sight
"There's a fire hi there!"
"Lord, those people ..."
The apartment full now of bustling busy people, yanking at the burning cloth,
pawing the debris.
"Good God, boy, why don't you put some clothes on? What's the matter with you?"
Numb but alert he stood, the tears streaming.
RE-ENTRY
169
31
"Finally cornered you," said an eager whisper at her shoulder. Claymore wheeled
to face Macklin grinning at her, his eyes bulging. "By far the most beautiful
woman^ in the hotel, and strangely lacking in companionship. Don't deny it! I've
been watching you all night--waiting for that old bag to go to bed and leave you
to me."
Confusion rendered her speechless. Her instinct was to brush off an offensive
pest, something she could have done almost without thinking--but it was as if she
saw him in double exposure, her knowledge of who he was, or rather who he would
be, short-circuiting her defenses.
Meanwhile he'd pressed her further into the shadows of the wisteria arbor. The
soft pastel light of the paper lanterns hanging from the trees in the courtyard
did not penetrate the gloom; his teeth and the whites of his huge eyes gleamed
in the darkness. "What's the matter, gorgeous? Some animal got your tongue?
Stinking planet crawls with them." He laughed. "Hope you're not a native."
"No," she said, pushing the words out to create space between them. "I'm from
Earth." She could smell the alcohol on his breath.    . , Wonderful!" he crowed.
"Not Washington, though--its a small town, I wouldn't have missed you, no matter
how high that old fart Ruiz's had me jumping." "I'm from New York--Mr. Macklin."
"No you don't! Ted, gorgeous. And you're--" "My name is ... Angela."
"Perfect! My angel, come to save me from death by boredom. Here, you've been
nursing that one much too long." He shoved a tall glass at her. t Meekly she
took the glass and sipped: rum. She hadnt drunk alcohol since she'd left the
Guild, and then only on business. She grimaced.
168
"Throw caution to the winds," he urged. "You're with me." He took the fruit
punch glass she'd been holding and tossed it into the shadows. It shattered on
the flags.
Her mind raced. Somehow she had to find a way to put Macklin off. The man _was
no more conceivable as a sex partner than her dead father. But her head was
filled only with the music drifting from the hotel ballroom. A quartet
Corelli...
"That's better! Take the edge off that thirst. Now tell me what's a nice girl
like you, and so on."
She looked at him, allowed a smile to play over her soft lips. "Just on
vacation, Ted. I happen to like animals."
"On vacation! That must be some business you're in, up there in Nuevo Yorko!"
When improvising, stay close to the truth--the first and oldest rule of lying.
"You might say I'm in the personal consulting business."
He got the point. "No wonder you're loaded, Angel. I take it back about the nice
girl." He gave her an appraising look. "I bet you're good though. So what would
it cost a guy, say for..."
'Talk to me when we get home, Teddy." She cut him off, then let her smile turn
mocking. "I told you, I'm on vacation."
He snatched the drink out of her hand, spilling half of it on her silk skirt,
"Cunt. If you're not working you'll put out for free--"
"Where have you been, dear?" Clarissa Sirich demanded, stalking into the shadowy
arbor in the manner of an enraged duenna. "And Mr. Macklin! Really, I hardly
expected ..."
Macklin snarled under his breath, pushed roughly past Sirich and stalked toward
the ballroom, tossing the superfluous glass aside to crash, like the first, on
the paving stones.
Claymore felt nauseous. She held her stomach while she tried to smile at Sirich.
"He's hard on the glassware--"
"Macklin." Sirich watched him disappear, then turned a sardonic eye on her
companion. "The survivor."
"You put him up to that!" Claymore blurted. "You do something about him." She
allowed herself to show her strain. "You brought me here, Clarissa; do you think
you're deceiving me?"
Sirich's ancient face lifted in mild surprise, "Yes. I thought Ffl been
deceiving you rather successfully." ;.; Claymore recovered. "Forget it. Why
should I blame you?"
170
RE-ENTRY
"I don't blame you for what that man is either." Sirich shrugged. "Besides, they
say people grow into office--"
"Oh, but that is the way he is," Claymore said with feeling.
Then she was silent, biting her wet lip. "The truth. But
getting rid of one son of a bitch won't change anything.
They're all like that." She pulled the scarf from her neck and
dabbed at the stain on her thighs.
'Too bad about the Holder baby though, isn't it?" Sirich said. "And all those
others."
"Too bad Cain killed Abel," Claymore snapped. "What do you want me to do, go
back and yank the apple out of Eve's mouth?"
"Interesting thought experiment--would anyone survive it? But don't misinterpret
me, Angelica, I have no desire to see you change the world. Would I have given
you my full cooperation if I did? Would I have arranged things so you could be
wherever you wanted to be, without interference, so you could fulfill your
ultra-conservative mission? I think you understand that without me you never
would have gotten
half this far."
"Of course I understand that. But I don't understand why.
And I don't trust you."
"You have no reason to; perhaps I should give you one. Come with me, Angelica.
Sit down with me." She took the younger woman by the arm and led her toward a
small table, under the lantern-bung branches of the huge spreading banyan in the
center of the court
A waiter approached, but Claymore shook her head and he went away. Around them
in the darkness couples and larger groups formed, dissolved, and reformed, all
members of the goodbye soiree given by the Darwin government in honor of Richard
Ruiz's visit. Human language flowed about Claymore and Sirich, as
incomprehensible in source, as inevitable in force as the dumb blind elan of the
twisting vines and branches. When Sirich began to speak, her voice was as rich
and supple as old leather. "What would you think of someone possessed of great
and powerful knowledge, Angelica, knowledge that could shake the universe to its
foundations, who was willing to risk it all on a personal quirk? A quirk like
honor, say, or curiosity, or a mere personal opinion ..."
"I wouldn't know what to think. Perhaps she's a hero.
Perhaps a lunatic."
RE-ENTRY
171
"Let me tell you a story. Do you know of Evariste Galois?"
"The name doesn't mean anything."
"Early 19th century O. E.; ancient France. A student of some sort. His politics
were considered radical at the time-- I admit I haven't any notion of what the
issues were, but I understand that most of the bright young people of his day
were radicals. He was undisciplined, rude, and badly educated
---this last because he refused to study what didn't interest him. Also because
he was so far beyond the capacities of the best instructors in what did interest
him that they could not follow what he was saying, and thought him stupid. Thus
he learned contempt, an attitude that betrayed him, as it has
-many others." Sirich spoke with the assurance of one who knows. "Honest
cynicism, while intellectually respectable, makes it impossible to distinguish
among competing human values. Survival may be valued more highly than awareness,
for example, or vice versa. Love displaces reason, or the reverse. In Galois'
case, he fell in love with a prostitute."
Claymore said nothing--she'd told Sirich nothing of her past--but she felt a touch
of cool pity for this fool Galois.
"Even after he found how easily her honor could be bought, he continued to
defend it for the sake of his own," Sirich continued. "His political rivals took
advantage of his extravagance and insulted the woman in his presence. He came to
her aid and found himself challenged to a duel. He felt he had no choice but to
accept, although the man who challenged him was a fell marksman."
"Perhaps I have heard this story," Claymore said. "In some other context."
"Perhaps more than once. Great legends never die--they are metaphrased," Sirich
remarked. "The night before the duel, knowing he would surely be killed, Galois
wrote down everything he knew of mathematics. It was his estate and his wfll,
all in one--he had nothing of value to leave behind except his ideas. He was up
all night writing--they used quill pens and ink in those days, writing was a
tortuous process-- and in the morning he stuffed the papers into his pockets and
went off to be shot. Perhaps out of contempt, his assassin shot tarn badly. He
didn't die until late into the night. His younger toother held him in his arms
and wept for has agony. 'Don't cry,' Galois said to him. 'I need all my courage
to die at twenty.'"
"Twenty years old," It was a silly romantic tale; Claymore
172
RE-ENTRY
RE-ENTRY
173
j /A
tried to hide her emotion. "What became of his papers?" "Oh, nothing, for about
fifteen years. Nobody could understand them. At last they came to the attention
of a superior mathematician, who not only recognized their worth but had the
influence to get them published. Did I mention this is a true legend?" Sirich
asked. "On those scraps of paper he'd written so feverishly, Galois had sketched
the foundations of the theory of groups and, virtually single-handedly, invented
modem abstract algebra."
"I'm suitably impressed, Clarissa, Sincerely. But.. .** "The connection? Like
Galois, I have knowledge to shake the universe, at least the universe of
thought." She smiled, but it was not a cheerful smile. "Like Galois, I lack a
sense of proportion, though, unlike him, love and honor are not my vices. I have
no more honor than a crocodile, a creature to which I have sometimes been
compared." She leaned back, deeper into shadow. "Curiosity is my particular
vice; I will go to almost any lengths to satisfy it; I will cheerfully risk my
own life and the lives of any number of others to find out something I want to
know. As for you, I would have betrayed you a dozen times over if it had suited
my purpose. So far, at least, it has not."
"I don't believe you," Claymore said, worried, reaching out
for her friend's hand.
"You are so desperate for love that you will grasp at the rankest counterfeit,"
said Sirich coldly, withdrawing her hand before she could be touched. "I've been
able to fool you only because you want to be fooled. Your talent in the
persuasive arts is at least the equal of mine, though I have a few extra years
of experience. The prostitutes taught you well --naturally I know your history--
they taught you the methods of widening the eye, widening the pupil of the eye,
phrasing contradiction as question, phrasing command as compliment ..."
Claymore grew aware of her surroundings with a finely tuned sensitivity that
located each obstacle, each escape route, each human body within twenty meters
of the table.
"... the use of touch, the use of scent. Actors are universally distrusted
because they lie with actions and words as well, a purely human achievement of
which no dumb brute, trapped in the unambiguous language of behavior, has ever
been capable. Arid you and I are far more skilled than any sensie star; to each
other we should be as open books..."
Far from losing herself in anger or self-pity, Claymore felt as if she were
emerging from a blinding fog of dull emotion.
"... yet somehow you have persuaded yourself that I care for you!" Sirich said
scornfully.
Claymore weighed her chances of killing Sirich without being detected, or at
least without being detained. The deed could be done easily.
"And still you cleave to this insane mission." Sirich paused to study Claymore's
reaction. "For the sake of your precious status quo you will protect this
narrow, selfish man, Macklin, who will fail to pursue the policies of Richard
Ruiz--who is, I grant you, an equal son of a bitch, personally--and thus hasten,
if just a little, the cultural collapse of your nation and your planet. Macklin,
a man who will diminish the quality of billions of lives by his mere continued
existence! Of course your mission is meaningless, whether you act or refrain
from acting, but the self-deception you have practiced...! Not only can you not
affect the history of your world, you can never even return to it."
"Why do you want to torment me?"
"Will you kill me? You can do so easily," Sirich laughed. *Tm curious about
that. I also wonder if you have what makes a human as clever as an ape--do you
have curiosity, too?"
Because Claymore did, she would not answer.
Sirich grinned wickedly. "I have no need of you or your beautiful space-time
ship any more, Angelica. You have taken me everywhere I was curious to go. The
Griffin will carry me on from here."
**Once I accused you of being suicidal," Claymore said, genuinely surprised.
"Was I right after all?"
The Griffin is destroyed, but for a few survivors. Everyone assumes all the rest
are killed. I think not."
"You still think Holder will...?"
**I suggest he's dead. Perhaps the smugglers killed him. Or perhaps he only lost
his nerve."
Claymore studied the woman, so very hard to see in the
deep shadows. The sounds of the string quartet drifted from
the hotel--Mozart now--and Sirich seemed to be smiling
again: the contempt she'd mentioned earlier?
y.   *"A final word of advice," Sirich said. "You are skilled, in-
ttffigent, a superb mercenary by inclination and training.
i/|Kou have a marvelous piece of equipment at hand in that
174
RE-ENTRY
RE-ENTRY
175
ship of yours. Take it. Use it. Go find a war--Brindle's a good bet, they're
always fighting about something. Live like a goddess instead of a slave."
"I have a better idea," said Claymore. "I'll give you a lift
up to the Griffin."
Sirich cocked an eyebrow. "Do you still believe Holder will show up? How
romantic of you! Perhaps you have reason-- how his Hippocratic heart must bleed
for all those lost souls."
"Perhaps I've overrated Holder, Clarissa. Perhaps I should have been watching
you all along."
The old woman's eroded face smiled even wider. "Indeed, Angelica, you are the
equal of any ape. That's why 1 took a chance on you and booked two passages on
the Griffin."
32
A few hours after his neighbors took him to the local clinic, Phil was released.
His biochemical profile revealed he was not in violation of either the genetic
laws or the controlled substances laws, and that--although mildly depressed--he
constituted no danger to his own or anyone else's health or well-being. The
bored psychiatric technician snapped her purple gum, gave him the pills the
computer prescribed, and sent
him home to rest.
Meanwhile he'd changed his mind about letting Maya go, as he knew he would (the
ability to predict one's own behavior does not imply the ability to change it).
Unfortunately, she'd cleaned the apartment of every negotiable moneysliver-- he'd
watched unprotesting as she'd rifled his pants pockets-- and be could find only
one half-used transitsliver in the pocket of his winter cape. But right now he
needed transit
more than food.
He took the levitrain to Cuvier Port. From the train's windows he watched great
dirigibles, their towering gray fabric sides rendered pale blue by the distance,
rising with slow
dignity from their moorings on the far side of the field, bound for the distant
continents of Darwin.
He waited in the tacky lobby, a collection of barely distinguishable souvenir
shops, bars and restaurants, restrooms, baggage and transportation facilities,
choked with vines and bushes and flowers like all the cramped dull architecture
of Darwin.
On the field, orbital shuttles accelerated rapidly down the long magnetic launch
rail, spread thin silver wings, and soared a thousand meters into the sky before
igniting rockets and rapidly dwindling from sight. Passenger manifests were
publicly displayed in the lobby facing Customs, so Phil knew - Maya hadn't left
the surface yet. The last shuttle for Griffin would leave at midnight.
He curled up on a padded plastic bench where he could keep an eye on the Customs
enclosure, and half nodded off. He was glad his passage aboard Griffin was non-
transferable; otherwise there'd be no point in his waiting to go with her, for
she'd have cashed hi his ticket hours ago. What kept them going through all
this, time after time? His commitment to her went deeper than the obligation of
support, which so far as she was concerned would expire in a few months anyway,
with the end of their first triad. And he sensed that in her twisted fashion she
had a commitment to him as well...
It was a little over six years ago that Dad was transferred to Pleistocenia--a
promotion, a move up the evolutionary scale. That was the year they let those
people out of Reeducation. Some of them ended up back in Dad's new territory. I
hope they "never realize it.
7 met Maya while 1 was going to school in Cuvier. She was a tour guide on one of
those little hovervans that take tourists around the Esplanade. It was the hair--
the others who went straight had their hair and skin altered. She kept that
yellow hair people stared at.
So it was easy to find out who she really was, even though the information was
supposed to be strictly confidential. Dad had his own files. She was the middle
daughter of Ariana's family. One disappeared; the other, the oldest, went to the
reservation with the men. Their mother was killed that day ...
Maya let me take her out a few times, she even invited me over when her friends
were there, but never alone. They
176
RE-ENTRY
weren't my type, really: starving poets, would-be actors like her. She wanted to
be in the sensies; I thought that was cute but sad. There was that one very
nervous psychiatry student who was the drug source, I think, and those junior-
exec Rangers who were chasing her "primitive" body. Maya*s Minions, that's how I
thought of the whole motley crew. She never admitted me to the inner circle
until somehow she found out who Dad was...
Then all those years I didn't see her, off at Esperidan; me scared to say boo in
a world richer than I'd ever imagined; meeting Unwin, the real T.T. Unwin; and
then a favorable alignment making it cheap enough to come home for a visit. I
still don't remember just how it happened. There was the sex, of course. The way
I was raised, I thought it was strictly for animals--that's the Darwinian
utilitarian cant of Biology with a capital B, as bad as Old Era Christianity for
creating guilt, and without Christianity's utility in providing convenient swear
words. Like all proper little Darwinians, I wasn't sure where to draw the line
between humans and animals, but I was sure as hell anxious to maintain the
distinction. Maya didn't see things that way, despite Re-ed. She made me feel
perfectly beastly.
There was another distinction I wanted to make, that between myself and Dad.
Marrying her was a way of making up for what he did, maybe. But I wonder what
she had in mind when she married the son of her mother's murderer? Maybe thafs
another distinction she doesn't draw ...
The marriage was secret for about a month. I have to laugh--her acting so
domestic for me during the week, me acting such a loyal son when I went home to
the folks on the weekends. I remember feeling pretty independent for a while
back when I was thirteen or fourteen; but that revolt withered somewhere along
the way, for lack of encouragement.
We had to tell everybody when we found out she was pregnant. You don't get an
abortion on Darwin, unless you can prove the child wouldn't survive on its own.
I was always surprised by how fast that happened--birth control is certainly not
illegal. I think now it must have been the first night she was sure I was going
to marry her.
The folks were so good about it I couldn't believe it. Maybe they thought it was
some kind of deserved punishment-- TIO, that's the way I looked at it. Maybe they
just wanted to
RE-ENTRY
177
give us the best start in a shaky situation. They sent us both back to
Epseridan.
Then Kenny was born and the fights started...
He woke up when the limousine from the Burton arrived outside the terminal,
stopped its engines with a sigh, spread its rubber skirts and kneeled to the
curb. The doors opened and a crowd of spoiled, intoxicated children of wealth
swirled into the terminal. And there was Maya in the midst of them, her baby
asleep on her shoulder.
Phil stood up, grasping his suitcase. He watched unnoticed as she swept past
him, a tall, thin, ghostly blonde among dark strangers. He stumbled along in the
train of happy passengers, keeping Maya's bobbing golden head in sight as they
approached the Customs barrier. She showed her ticket and identification to the
machine and swept through the gate without delay. In a moment she was outside
the outer doors on the concrete, stepping into the little electric trolley that
would carry the passengers to the shuttle The shuttle's slender silver hull sat
poised at the end of the catapult, bathed in yellow light.
Phil stopped, ignoring a man who bumped him from behind and cursed him
indignantly. Lightheaded with hunger and fatigue, he staggered to the rail
surrounding the Customs enclosure and watched the others push through the gate.
He realized, with a certainty that made him want to weep, that what he truly
desired at this moment, more than anything else in the universe, was for Maya
simply and finally to disappear out of his life.
But then an old memory rose unbidden in front of his eyes, the face of a man
he'd known once, briefly; a man who claimed to be no one at all; a man who'd
tried to change his life in ways he only vaguely understood to this day. He knew
tile man would be disappointed with him, angry at him-- angry that having come so
close he had failed to act

He pulled out his ticket and rejoined the line.
When he got in the tram Maya looked at him contemptuously. "I wondered if you'd
have the guts to show up." She gave the sleepy baby to him.
They rode in silence to the shuttle. Other passengers exclaimed and pointed when
a great black sleek ship with Earth markings rose in a fountain of golden fire
from the far side
178
RE-ENTRY
of the field. "The Sprint," they said, excited. The mysterious craft had been a
subject of much speculation since its arrival several days ago.
But Phil and Maya said nothing.
33
Follow a beam of light drawn up across the stars, bright as a molten wire; find
its source in the reaction chamber
of Griffin.
The thin, clean beam derives from fused hydrogen, and the liner, now a week out
of Darwin, accelerates under fusion power because it is inside the statutory
"life zone" around Darwin's Star. That condition will soon end.
Above the reaction chamber and its ordinary hydrogen tanks stand two vastly
greater cylindrical mass tanks, many hundreds of meters tall, woven together by
an intricate tangle of plumbing. One tank contains meson-superhydrogen, the
other baryon-superhydrogen. A superhydrogen reaction is roughly ten thousand
times more powerful than the fission of a comparable mass of plutonium, and very
dirty. When the heavy quarks in the nucleons of one gas annihilate with their
antiquarks in the nucleons of the other gas, all hell breaks
loose.
High atop the enormous superhydrogen tanks perch the liner's comparatively tiny
passenger decks, stacked like saucers: housekeeping sections below; cabins in
the middle; dining salon, ballroom, and promenade deck next; and on the top of
the stack, the recreation deck, with swimming pool, bars, gymnasium, galleries
and lounges, all roofed with tinted
crystal.
A hangar deck, little better than a tangle of mesh platforms and catwalks, gives
access through tubular airlocks to a cluster of landing craft ringing the ship,
including private
yachts in tow.
The bulbous command-and-control module, bristling with
RE-ENTRY
779
sensor and transmitter antennas and shield-field generators, surmounts all.
To those antennas your message is aimed. Key the demand frequency...
"Ladies and gentlemen, if I may have your attention for just a moment--" The
white-haired, craggy captain stood on a shaded portico flanked by Grecian urns,
overlooking an arm of the sea rather too blue to be called wine-dark. In the
distance, rocky heights glowed cantaloupe pink in the rays of a setting sun: the
entire scene was a mural hi the style of the old master Parrish.
The audience glittered with jewels and ribbons; perfume and power mingled in the
close air of the elegant salon.
"We'll be lighting up our beam in, oh, an hour from now or thereabouts, pushing
off into deep space, and I'll have to be leaving you then to look after things,"
said the captain, "so I did want to take this opportunity to express how deeply
honored all of us on the staff of Griffin feel to have aboard our vessel the
congressional delegation from the United States of North America, Earth, led by
Speaker Ruiz--"
The captain paused to allow polite applause. He smiled at Ruiz, one commander to
another. The tall, graying man with the oddly delicate mouth nodded back.
"And we're equally honored to have with us the Republic of Darwin's trade and
cultural mission, led by Dr. Sirich." He bowed in the young Sirich's direction,
while the guests applauded the woman with the clear dark eyes and the frank
appraising stare. "And before my throat runs dry, I'll join our eminent guests
for a spot of celebration."
The captain stepped nimbly off the dais and took a bulb of what appeared to be
brandy, actually tea, from the rack held out by a steward who had appeared on
cue. The captain moved through the crowd, chatting affably. Considering the
volatile nature of his passenger manifest, keeping everyone friendly on this
cruise was almost as important as keeping the ship functioning smoothly.
Phil Holder tugged at the uncomfortable formal scarf around his throat, and
gazed moodily at his wife. Blonde and several centimeters taller than the norm,
Maya could not be missed hi the crowd of typically dark-complexioned partygo-
ers. Her. appearance betrayed her origin to the Darwinians on
180
RE-ENTRY
RE-ENTRY
J81
board, and made her the object of attention and comment to the others. He cursed
the ill luck that had booked them on the same ship to Epsilon Eridani with this
collection of the powerful and famous.
Now her blonde head was plowing through the dark sea in his direction, and he
assumed she'd completed her mission of having their infant son kissed by the
American Speaker-- a scene he'd refused to witness. When embarked on social
mountaineering, Maya's dialogue was just too cloying to
bear.
"Here, do something about your son," she said, her voice hoarse from smoke and
chatter. She thrust the blanketed bundle in his direction. "Smell that? He would
have to shit just as Ruiz was about to come our way."
"You'll have other chances," said Phil, taking the sleepy, grumpy boy. "Ready to
call it a night?"
"Take care of him, I said." She turned her thin nervous features away, scanning
the crowd with little jerks of her
head.
"Maya, will you please.. .** But she was already leaving, the skirts of her
shiny translucent maroon gown switching about her legs. Phil jiggled the boy on
his shoulder, turned, and went into the central corridor toward the elevator
shafts.
Richard Ruiz was exchanging some small talk with the Griffin's captain when a
junior officer pushed her way through the crowd and whispered something in the
captain's ear. He turned to Ruiz with an expression of regret. "I'm told Darwin
has raised us on the radio with some news I should hear. Damned inconvenient,
but they pay no attention to the time we're keeping."
"Please, don't be concerned on my account," said Ruiz.
"Good of you. I'll be back shortly." The captain headed immediately for the
central lift tubes, not rushing, but wasting
no time.
It was clear to Ruiz that something important had come up; he was sure he would
hear about it if and when he needed to--he had complete faith in the captain's
judgment. Ruiz congratulated himself once again on his perspicacity in choosing
the neutral Cetian liner to ferry him and his delegation on their sensitive
mission to the major planets of the Archipelago. The ship was old, but it had a
certain grace the newer ships lacked, reflected hi its small but tastefully
appointed
rooms, done in polished wood and brushed metals and roughly textured fabrics.
The Griffin somehow managed to convey a reassuring sense of steady permanence.
That was just the image Ruiz himself hoped to convey. Despite its tribulations,
Earth was still the most powerful planet m the Starry Archipelago, and the USNA
could still claim to be the most powerful nation on Earth. But if diplomatic
ties with other planets were not constantly and carefully maintained, the
situation could easily deteriorate. He was grateful that the Darwin group
appeared ready to give him solid support
He eyed the woman, Sirich, who headed their delegation. He was certain she was a
much more important figure in Darwin's Central Council than she pretended to be,
despite her anomalous youth--barely forty, he'd guess. But it was always tricky
guessing where the real power lay hi these nations with democratic pretensions.
Sirich turned and looked at Ruiz then, and smiled. He raised his bulb hi her
direction. He excused himself from the man who'd been talking steadily at him--he
hadn't heard a single word--and made his way toward her.
Angelica Claymore stalked the edges of the crowd, the white silk of her loose
trousers and jacket whispering against her limbs. She was tense with
anticipation. If she'd been accurately briefed, matters should come to a head
within the hour. And old Sirich should know--she'd been here before.
Claymore found her fascinated gaze drawn once again to the youngish woman
talking to Ruiz. She seemed no more than a decade older than Claymore herself,
with long black hair just beginning to show streaks of silver: a woman who held
a high but mysterious position in the government of Darwin. Clarissa Sirich.
The official files she'd read on the Griffin disaster made no mention of
Clarissa Sirich. But those were the files available on Earth; there'd been no
time for her to get the complete records of the inquiry from Tau Ceti. She'd
been surprised at the time at how very sketchy the records were--not even a
passenger manifest--given that the wreck of the Griffin was a pivotal event in
recent USNA history. She suspected now that Macklin had arranged matters to
prevent anyone from contradicting his self-serving memories of the heroic , acts
he'd performed during the ship's dying moments.
782
RE-ENTRY
Macklin--the man for whom she'd traversed the years and the light-years: there he
was, in the corner by the portable bar, malting a determined pass at Maya
Holder. Or perhaps it was the other way around? To Claymore's eye the batting
lashes and the twitching rump in the see-through maroon dress were contemptibly
obvious, but then Macklin was not a man to appreciate subtlety.
Now the two of them had moved to the foot of the winding stair that led up to
the galleries and lounges above, on the top passenger deck. That deck was dark
and practically deserted, with most of the passengers amusing themselves here in
the salon. Macklin whispered something and Maya laughed, and then his fingers
brushed the point of her hip, and they were moving casually up the stairs to the
dark gallery above--no doubt to catch the view.
Claymore started worrying about how Maya was going to keep her appointment to
blow up the ship. Only a few minutes remained.
Someone tapped at the door of the cabin. Phil crossed the cramped little room in
a couple of steps and opened the door a crack: it was Naomi, the wife of one of
the junior Rangers on the mission. "I'm putting my two to bed now, Phil," she
whispered. "If you want to patch your vidcom into our room 111 be happy to keep
an eye on Kenny for you." "I don't know if I'm really in a. party mood, Naomi.'*
"Oh, go on. You might have some fun." He thought about it; the baby would
certainly be safe with Naomi keeping watch. "Well, if you're sure it's not..."
"Hush. Go find your wife." "Thanks a lot, Naomi. See you later." He closed the
door. He recovered the formal scarf he'd taken off, wrapped it around his neck
again, and then keyed in the vidcom. He waved his fingers at Naomi in the screen
as she entered her cabin with her youngsters in tow, and he
saw her wave back.
He went into the corridor, and turned to pull the door closed; be lingered a
moment, taking a last peek at his son in the webbing crib--the boy was fast
asleep on his stomach, his lips formed into a tiny bow, his legs curled under
him and diapered bottom pushed high into the air.
Phil gently clicked the door shut
34
The lift door slid open. Phil followed the circular corridor around to the
salon.
Even more people had joined the party since he'd left it
" Stewards were busy circulating with racks of drink and food.
Dignity had begun to crumble; one man was being sick in an
urn. Couples were drifting upstairs to the darkened galleries
above. Maya was nowhere to be seen,
That worried Phil more than it irritated him; he clung to his responsibility. He
turned, shouldered his way past a drunken laughing woman, and started for the
stairs. He would look for her in the upper public rooms before asking questions.
An officer approached him. "Are you Mr. Philip Holder?" she asked.
"Yes. What's the trouble?"
"Mr. Holder, I've been asked to take you to the bridge."
"Is it my wife?"
"Please follow me, sir."
It was dark on the circular bridge of the Griffin, so dark that the numerous
officers and crewpeople were only silhouettes against the stars, which were
visible through the unshielded slit windows that encircled the deck. The only
lights were the blinking sapphire and amber and ruby patterns on the instrument
panels. The captain was bending over a communications console talking to two of
his staff; he straightened and came forward when Phil was led on deck.
"Please forgive this intrusion, Mr. Holder. Will you sit down, please?" He
caught Phil's shoulder and guided him firmly to a swivel chair. Phil sat, but
the captain didn't. "I'm going to have to ask you some rather personal
questions," the captain said. "I do so for the most pressing reasons. Your
cooperation is of the utmost importance."
183
184
RE-ENTRY
RE-ENTRY
285
"Is my wife all right?"
The captain turned to an aide; Phil noted he wore a side-arm with the holster
.unsnapped. The man nodded.
"She's perfectly all right, Mr. Holder." The captain drew himself up a little
straighter. "Now I must inform you that the Griffin entered deep space
approximately ten-to-the-third seconds ago, and we are therefore operating under
international rules, upon which I base my authority as absolute commander of
this ship. Do you understand?"
"I'll be glad to cooperate if you'll tell me the problem." "When we're done I'll
tell you all I can." The captain studied the tips of his polished brown boots.
"Mr. Holder, have you recently noticed any, um, strange behavior on the part of
your wife?"
... they sent us both back to Epseridan. Then Kenny was bom and the fights
started, and I started practically living in the library. People started giving
me weird looks. I heard her on the vidphone one night, she didn't hear me come
in, and she was talking about how much I drank and how I'd get high on olkane
and beat the shit out of her and slap the kid...
"Mr. Holder?"
"I would say yes, Captain. We've had some strictly personal problems for the
past few months."
And I started doing it, too. Not olkane; who can afford it? And not Kenny--but
I've been getting pretty boozed lately. Twice I've hit hert raised purple
bruises on her fragile white jaw...
"... I should add, if I'm going to be perfectly honest, that I've been doing
some heavy drinking, which I'm sure has contributed to our difficulties." He
spoke as if he were dictating
a confession.
"Believe me, Mr. Holder, these questions are as painful for me to ask as they
are for you to answer." The captain sounded genuinely distressed. "Tell me this,
has your wife ever been diagnosed as emotionally impaired?"
I never told her about Unwin. He never liked me much, anyway, and he wouldn't
say anything about the past except
that once--"So you're the chap that fellow was so anxious to meet"--but I pushed
some kind of forlorn displaced affection on him, for the sake of the other, and
finally that morning I tracked him down and spilled a year's worth of woe right
in his coffee ...
"No, Captain, she's never been professionally diagnosed."
... and he fast stared at me and said she was obviously crazy, paranoid
schizophrenia, probably, one of the simplest of organic problems, so why didn't
I just take her around to the infirmary and get her fixed up?
"And your personal opinion, Mr. Holder? Please understand this is in the
strictest confidence."
/ never met a "crazy" person. And on Darwin they don't mess with people's
chemistry. And Unwin doesn't like women anyway, he'd say anything ...
"We have our private disagreements, as I said. Sometimes they get a bit
melodramatic. Basically I think she's, uh, so-daily responsible."
... and besides, she's got so many excuses, even my own behavior, and yes, she's
completely mad.
"All right then, Mr. Holder. Finally, will you describe your current plans,
yours and your wife's? Precisely, I mean what are you doing on the Griffin?"
I finished the B.S. with honors, maybe because they give points for agony. I was
supposed to go on in biochemistry, but I ran out of will and energy. I quit. We
all went home--I can't believe that was just four months ago! We ended up in that
same little apartment of hers and I got a job counting chromosomes at the
Institute and her creepy friends started coming around. But this time I think
she found them just as pretentious and parochial as I did, mere apes of the
trend tetters in Epsilon Eridani. Thafs where she wanted to be, in the center of
the universe..., ' She knew what I wanted to do, but I wouldn't tell Dad.
186
RE-ENTRY
RE-ENTRY
187
Hadn't the folks done enough? I didn't really give a damn about animals. I was
interested in people. So she told Dad what I didn't dare to. And Mom and Dad
came through again.
"I'm going back to medical school, Captain. That's about all there is to it."
The captain looked at his aides, who were dark shapes towering above Phil in the
whispering, blinking gloom. No one moved. At last the captain said, "Only one or
two more questions, Mr. Holder. Come with me, please."
He led Phil to a communications console. He patted the console operator on the
shoulder hi a fatherly way, and the young man touched some keys. The screen
lighted; a man's head and shoulders formed.
"Mr. Holder, this man claims he has evidence that your wife is going to destroy
this vessel. Do you know why anyone would say such a thing?"
Phil could only stare. Ten years, and he's aged hardly a
day...
"Mr. Holder, do you have any idea who this man is? Or why he would claim to be
you?"
So little of his proper time had passed since Holder had stolen that lander from
Humboldt. In the interim the years, the very decades, had flowed artSund him
like a mountain stream, falling in abrupt cascades or lying still in quiet
pools, but never ceasing to flow.
Most space travelers took whatever measures they could to avoid becoming victims
of the twin paradox. Not Holder. The mechanics of time travel into the future
had been thoroughly understood since the days of Einstein's lagging clocks and
shrinking rods; the Lorentz transformations are not only precise, but
relentless.
Cormorant had looped Darwin Station at a substantial fraction of light speed and
had dived straight back toward the planet's orbit The immense gravity of the two
holes accelerated the craft on the approach and slowed it on the return, but
when Cormorant crossed Darwin's orbit the planet was on the other side of its
sun--a celestial-mechanical oversight in Holder's programming instructions that
nearly proved
fatal.
Furiously calculating the intervals between all useful sets of space-time events
known to him, Holder at last ordered
Cormorant to expend most of its precious remaining super-hydrogens decelerating
inward toward Darwin's star, swooping close to that fiery sun to cut across
Darwin's orbit. If he had correctly estimated the delta-v's, Cormorant should
overtake Griffin at a roughly matching velocity when the liner was less than a
week out on its own journey to Darwin Station. That was cutting it almost too
close to call, but it was the best he could do.
Once made, the decision was irrevocable. Three weeks later, Holder could just
make out the indistinct speck that was Griffin, swamped against a glittering
starry background, through the unshielded windows in Cormorant's nose. On the
viewscreen the liner appeared close, but Holder knew he still had a long way to
go. Weeks ago he'd jettisoned the dead mass of the living module and tanks, and
the fuel in the lander had dwindled away to almost nothing. But he had to keep
accelerating until he caught the Griffin, or become derelict.
The communicator screen glittered, and the lights coagulated into the image of
Griffin's captain. "Cormorant, we have Mr. Philip Holder on the bridge. He tells
us he has no reason to suspect his wife of planning to cause problems. He also
tells us that he recognizes you, but-that he has no idea why you are using his
name--except that you seem to have a penchant for borrowed names. For what it's
worth, he says that even though he doesn't know who you are he trusts your
intentions."
"That's an honest answer, Captain," Holder said.
*Tm in no position to judge, Cormorant." "What have you decided, Captain? I'm
running .. .** "Yes, you're running very low, Cormorant. Your telemetry tells us
that. Nevertheless you're currently on the optimum heading for a rendezvous, so
neither time nor fuel is being wasted. You understand I'm operating under
international law, which does not require me to alter my course to rescue you
if, in my considered opinion, doing so would endanger my passengers. Frankly, I
haven't made up my mind yet" "Captain, isn't there anything I can say ...?"
*Tve already told you the problems your story creates-- .quite aside from this
reverse time-travel business, which I must simply discount. Though I'm honestly
doing my best not to hold it against you."
"How good of you."
**And I don't blame you for being upset. But so far as we
188
RE-ENTRY
know there is no way, no way whatsoever, that this woman could do severe damage
to this ship without a sizeable bomb. We're doing a rescan of al! areas
accessible to passengers, but frankly it's a ridiculous proposition."
Holder was frustrated by his inability to answer the captain's eminently
reasonable objections--he'd never figured out how Maya had done it, either. But
he had no doubt she had. He could never forget the explosions that had wracked
Griffin, the inferno that had greeted him when he'd pulled open the door of
their cabin... The hellish vision had lived with him for twenty years.
Maya had not survived to tell anyone how she'd pulled it off. There seemed to be
nothing anyone could do to interfere with the functioning of an annihilator from
inside a second class cabin almost a kilometer away from it.
"Unless, Cormorant," the captain was saying, "you are carrying the bomb."
Holder froze. "I'll jettison my ship," he said immediately. "You're willing to
come across on a line?" the captain asked.
Holder nodded.
"You understand we wouldn't stop accelerating. Once you got on that line you'd
be falling toward our stern. We'd bring you in as fast as we could, but if your
ship burned out before we got you across..." "I'll take the risk."
The officer hesitated. Then he said, "All right. We'll transmit final approach
vectors to your machine. Be warned, Cormorant, if you vary from them by one
degree we'll torpedo you without query."
"If I may make one suggestion at this time..." Holder fought to keep his voice
calm. "I urge you to allow Mr. Holder to join his wife immediately. And have him
stay with her."
"He's already made the same request, Cormorant. He's on the way. Under guard.*1
35
Macklin's hand rubbed Maya's arm with dull insistence.
"That's a very bold suggestion, Mr. Macklin," she said; she left the arm lying
there across the back of the couch, neither encouraging nor discouraging him.
"I told you to call me Ted. And I noticed you're not running away."
She studied him over the bulb of brandy fluff he'd brought to her.
"I also noticed nobody seems to be looking for you too bard," Macklin went on,
"so don't tell me you're going to be missed." Earlier, on the way up the stairs,
she'd casually moved a breast against his arm, a hip against his thigh, but
she'd stiffened once they'd settled on the couch. "Come on, baby, relax a
little," he coaxed.
Great curving windows of crystal opened onto the star-dusted universe, only a
few meters in front of their couch. Couples in silhouette passed restlessly to
and fro, stirred as if by invisible winds. The only light came from the burning
amber eye of a beacon on the hangar deck overhead, shining through the roof
plates; Darwin's Star, the nearest sun, was below the ship and on the other
side.
Angelica Claymore quietly threaded her way among the thickly upholstered couches
and lounge chairs, taking care not to disturb their occupants. She gleamed pale
as a ghost in ber rippling silks. She had come to insure that Maya Holder was
not being detained against her wilL
In the yellow gloom Maya smiled, allowing a hint of tears to moisten her eye. "I
haven't really relaxed ... in such a long time." She leaned toward Macklin.
His grin broadened, his eyes and teeth gleamed.
189
190
RE-ENTRY
RE-ENTRY
191
Two men appeared in the doorway at the far end of the room, silhouetted against
the corridor light. "Maya?" Phil asked. "Are you in here?" There was no
response. "Maya?"
A low chorus of hisses and groans greeted him from the shadows. Undeterred, he
walked into the dark room, peering here and there, searching for her thick
blonde hair.
"Shit," Maya whispered- "Here comes Phil."
"Oh?" said Macklin, his voice rising a note. He leaned away
from her. "Well--maybe I should give you two time to get
things straightened out between you."
"Sure you should," she said with disgust. "Lover."
Claymore silently doubled back. She was convinced now that something had gone
wrong. The guard with Phil couldn't possibly have been a part of the original
equation. Time was short; she must take care of the immediate problems
immediately, and figure out the rest later.
She stepped up behind the guard, snaked one arm around his throat while the
other hand covered his nose and mouth. But she had to stand on tiptoe, and
almost lost him--he made one muffled, strenuous "mmmphh" that brought an amused
feminine giggle from a nearby couch, but no other reaction. Claymore took him to
the floor sideways, out of the light from the corridor.
She rose over the unconscious body, then moved rapidly along the wall, keeping
Phil in sight
Phil approached the couch that faced the curving windows. Two people were
outlined against the stars; the woman was blonde. The man suddenly stood up,
before Phil had said anything. The man tugged at his scarf, looked sideways at
Phil as if considering speaking, then changed his mind and walked stiffly away,
taking the corridor to the spiral stairs.
"Maya," Phil said to the seated woman.
"Shit," she said in a dry croak. "You are really bright, do you know that? Do
you know who that man was? Do you know what he could have done for your career
...?"
"I'm a student this month, remember?" he cut in, exasperated.
"... and you had to embarrass the man in front of everyone. Now he'll..."
*'Will you people shut up?" said a woman's voice from the shadows.
"Yeah, go argue somewhere else," a man put in.
"Come on, Maya, let's go," Phil said nervously, knowing that the situation was
rapidly developing into a one-woman show.
"Teach her a lesson," a drunken man mumbled.
"To hell with you, Herb," said a woman.
Maya stood, her golden hair reflecting the amber beacon overhead, her shadowed
face seemingly helmeted in glowing bronze. 'This is the end for you, Philip
Holder ..."
"What the hell's that?" the drunk exclaimed. Murmuring voices and rustling
clothes filled the quiet dark with sibilance, as people rose from their couches
and flocked like starlings to the curving windows.
A burnished yacht swept across the stars, its gleaming black skin reflecting the
full force of the invisible sun. With tiny explosions of ice crystals its
verniers aligned it vertically with respect to Griffin, and even as it began to
slide astern its main fusion engine fired with a steadily pulsing yellow flame.
Its position stabilized, and it kept pace with Griffin, almost a kilometer
distant.
"Somebody late to catch the ship?" a woman said. She giggled.
"That lender's got no tanks, no life module, not even a lifeboat," said a man.
"It must be in some kind of trouble."
"Damn it!" Maya said, and no one paid her the slightest attention. She balled
her fists and stalked the length of the room toward the central elevators, her
angry strides punctuated by the switching of her dress.
At that moment the captain's voice came over the public address system, speaking
softly from every corner of the room. "Ladies and gentlemen, Griffin is
extending aid to a distressed spacecraft. We have made no adjustment to our
flight plan, and none will be necessary,"
Phil, distracted, watched for a moment as a line, thin as spider silk, uncoiled
from the hangar deck overhead and arced toward the yacht. But even before the
captain stopped speaking he turned and followed Maya toward the elevators.
"This is a routine exercise and it will have no effect on our itinerary, I want
to emphasize that," said the captain. "We'll pass on further details as they are
available."
192
RE-ENTRY
RE-ENTRY
193
Claymore watched Phil go, saw him pause in the corridor for a moment, puzzled,
looking for his escort, but then move on. Perhaps he assumed the guard had been
called away. Claymore stood still, undecided. She was used to acting on less
than complete information, sensing what action to take and taking it; people who
waited to act until they thoroughly understood a problem were always too late to
solve it. But never had her data been so fragmentary. Why had Phil brought that
guard? Should she go after Phil now? And this ship in trouble...
She cursed herself for a distracted idiot, as the truth began to dawn. She
stepped close to the gallery windows, shouldering others aside.
She was in time to see the hatch in the distant lander crack open, with a
miniature snowstorm of frozen moisture rushing out of the airlock, the crystals
falling away as straight and fast as feathers in an evacuated bell jar. A tiny
figure in a white pressure suit appeared in the hatchway and fumbled with the
lifeline. The line itself was invisible.
"Why is that ship so far away?" a woman asked. At first, no one could answer
her. Finally a man suggested, "Maybe they don't want to risk a cpllision."
"Sure doesn't make it easy on the guy. If it is a guy." The little figure
suddenly fell from the hatch. The onlookers gasped. "Oh God," a woman said,
"they lost him."
But though the white figure fell steeply away, so that the spectators had to
crowd against the windows to follow the fall, it was immediately apparent that
the falling body followed a catenary, the natural drape of the invisible
lifeline in the constant acceleration. In a few seconds the gleaming speck had
reached a point midway between the ships, where it slowed abruptly, stopped, and
rebounded. The figure made frantic swimming motions. "He's trying to catch the
line farther up," someone said.
"Are they going to make him climb it himself? Why don't they pull him in?" "Be
patient."
The thin shining portion of the line they could see hanging from the landing
deck overhead now tautened perceptibly. Below them the figure in the pressure
suit was drawn slowly toward them. As the seconds crept past it came nearer and
higher; the spectators peered to see the identity of the rescued pilot.
Everyone had forgotten the abandoned yacht. Tiny compared to Griffin, it was
nevertheless sufficiently massive to hold steady under the jerking and bobbing
of one diminutive human. But suddenly its steadfast-rocket exhaust faltered, and
the engine soundlessly belched an enormous blossom of orange flames that sent
lurid shadows billowing through the view gallery. Without looking back the man
on the line started pulling himself hand over hand, as fast as he could move in
the bulky suit.
"Jesus," someone said. There was another soundless burst of light. "He'll never
make it."
The lander wobbled and the flame of its engine snuffed out, leaving angry blue-
black afterimages on the retinas of the blinded watchers. Almost at the same
moment a searing bolt of white light streaked into the lander from overhead and
the yacht vanished in a perfect oblate fireball--of which the onlookers saw only
the embryonic beginnings, for the gallery's self-shielding windows opaqued
instantly and the view outside the Griffin was cut off.
"They torpedoed it," a man said quietly, awed. "They must have killed him," said
a woman. "No," said another, "they were trying to save him, I think. Cut through
the line before it snapped and jerked him away." "I wonder if..."
They were interrupted by a woman's loud strong voice calling from the central
corridor. "Is Maya Holder in this room?" Luminous ceiling strips brightened. The
room's disheveled occupants blinked sheepishly at each other. "Maya Holder," the
woman repeated, imperiously. She was a uniformed guard. "Mrs. Philip Hoi... God,
what happened here?" She'd found the inert guard at her feet.
Claymore's hand moved behind her back and under her loose top, to rest on the
butt of the little stunner, tucked into her waistband over her spine.
Then the crystal windows dissolved to transparency. The pilot of the vaporized
lander was hanging immediately below the gallery, twisting in a loop of cable,
slowly being pulled to the hangar deck above.
"No one in this room will move until I say so," the guard ordered. She aimed a
firegun nervously in their direction. "Hands hi the air, all of you, right now."
Claymore ignored her, staring with fascination at the body outside the windows.
Slowly, slowly Upswung around as it
194
RE-ENTRY
RE-ENTRY
195
rose, until finally the fac^e came into view through the helmet
plate.
Not two meters away was Phil Holder, very much alive, Claymore drew her gun,
turned, and shot the guard.
Phil heard the pleading voice before he came around the curve in the corridor.
He discovered Naomi alternately banging on the cabin door and tugging on its
handle. "Maya, let me in, honey, before you do something to hurt yourself.
Please Maya."
"What's going on?" he demanded.
"Phil, thank God," said Naomi. Her relief was mixed with fright. "She came in
and started tearing the place apart, ripping up all your clothes, pulling the
sheets off the bunk-- she's acting crazy! She's stuffing everything down the re-
cycler 1"
"Maya, damn it, come out of there or I'm calling an officer!" He kicked at the
door.
"Can't she start a fire that way?" asked Naomi.    *
"That's what she's trying to do," he said. "Is Kenny still in there?"
"Oh Phil, I'm so sorry, but I didn't have any warning."
"Not your fault, Naomi. Would you run call an officer as fast as you can?"
She nodded, bit her lip, and scurried away.
Phil didn't think Maya could start a fire; these ship receptacles didn't operate
the way_the usual apartment units did, as self-contained high-temperature
elements. He'd heard somewhere that on a spaceship the chutes were all connected
centrally, for safety. He hoped he was right.
But he couldn't be sure of anything. He hurled himself against the door, trying
to tear it from its hinges. Inside he could hear the baby wailing.
Holder knew that room, the one full of people staring at him. That was the top
deck, the gallery where he'd caught Maya with that guy, whoever he was, had that
big fight with her. Just before she went downstairs.
He hadn't seen them in there. But if Phil was with her, and if a guard was with
them both ...
Webbed polysteel struts passed hi front of his face--the loading jetty. Suddenly
he was dangling above a floodlit landing deck. Two suited crew members grabbed
him by the arm,
one on each side, and guided him toward an airlock. One reached up and unsnapped
the curb by which he'd attached his suit harness to the lifeline. Holder sagged
to his feet, exhausted.
They helped him into the airlock and tossed aside their own safety lines. The
heavy doors slid together, interlocked, and sealed. A rush of sound, low at
first, then louder, announced the return of atmospheric pressure. Red lights
over the inner doors blinked to green. The two crew members kept their firm grip
on him.
The inner doors slid aside. A brace of guards leveled fire-guns at him; behind
them it was too dark to see anything. "Take your suit off," said the man beside
him, in a loud, hollow voice. "In here."
Holder stripped off his pressure suit. The two crew members stood back,
watching, staying inside the lock with him and keeping their own suits on. He
realized that if he tried anything they didn't like, they would simply close the
lock again and evacuate it. He didn't blame them for being scared; he was scared
too.
"We've recovered the unfortunate gentleman in excellent condition." One could
almost hear the warm smile in the captain's mellow voice as it flowed from the
speakers. "As promised, our own course and schedule have been completely
unaffected."
The party guests broke into sympathetic applause. Richard Ruiz turned to
Clarissa Sirich. "Quite an engaging performance, See. The captain neglected to
tell us the name of the star."
She looked distracted. "Richard, your instinct for danger-- is it well
developed?"
"In politics?" Ruiz smiled delicately. "I assure you ..."
"Immediate physical danger. I've got a strong sense for this kind of thing.
Something's about to happen, something bad."
"Something just did, See. If that fellow had been a few seconds later... You're
probably feeling the reaction."
She shrugged. "Maybe you're right." She sipped at her drink. "Tell me about your
program."
He looked at her in surprise. "I've been talking about it for daysf
'Tell me again. While we walk." She hooked her finger in his jacket and tugged.
He followed.
196
RE-ENTRY
His eyes lit up. She really was an attractive woman, after all. He'd had little
time for women since the death of his wife many years ago--not from lack of
interest, but rather from lack of confidence, if the truth be told. Certainly
he'd had no indication from Sirich that she thought of him in that way. The
sense of danger, maybe? He'd always been impressed by those stories of fruit
trees that blossomed frantically after they were cut down... He helped her push
through the thinning crowd.
The captain's voice returned on the address system. "Despite all the excitement,
our program has been moving along uninterrupted, as I've emphasized. And so, in
just about five seconds now, we'll be lighting the annihilator. I'm sorry I
won't be there with you in person for the traditional toasts, but things have
been a little busy. Here we go ..."
Another little cheer was punctuated by tipsy shrieks and laughter as the floor
dropped away and then came right back up again a hair more vigorously than
expected, like an elevator bumping to a rough stop. Three people fell down,
whooping and giggling; still, the old hands in the crowd pronounced it a
remarkably smooth cross-over.
"That's about as cleverly as we can do it," the captain was saying, but the rest
of his remarks went unheard, for a woman ran screaming down the spiral stair
from the gallery above.
"She's killed her! Call for help! Oh God, she's killed the guard!"
When Holder was stripped to the plain dark trousers and sweater he'd worn for
the last several weeks aboard Cormorant, they gestured him into the interior and
frisked him with a squealer. The airlock closed behind him. They led him up a
flight of steps and through twisting corridors, under close escort all the way,
and finally onto the darkened bridge.
The captain turned as Holder was brought to him. "You, sir, are the luckiest man
I've ever met," he said.
"I hope to be luckier still, Captain. Where is Mrs. Holder now?"
"I've assigned two guards to be with her and her husband. If I may say so, sir,
my staff has done things on your behalf that..."
"And I sincerely thank them for it, and I thank you, Captain. Would it be
possible .. .T
RE-ENTRY
197
Ruby lights were suddenly flashing everywhere on the intercommunications board.
"Excuse me a moment," said the captain.
The security officer bent over the intercom, pressing phones to his ears,
mumbling into the mike at his throat. Holder caught the words: "... damage
control fire team to G, Room G-412. Assign one armed guard. Guard detachment to
A, Room A-3 view gallery, seek armed woman dressed in white, extremely dangerous
..."
Holder stared about wildly. The bridge personnel were distracted by the multiple
outbreaks of bad news. He bolted for the open elevator door.
Behind him he heard the captain cry out, "Stop him! Stop that man!"
Angelica Claymore had memorized the layout of the ship as well as she could in
the few days she'd been on board, but she hadn't had time to penetrate the maze
of the command-and-control module. Rather than take a chance on losing herself
among the winding corridors and catwalks and stairwells that branched from the
hangar deck, she preferred to take an elevator to the top. Take it by storm, if
necessary.
Claymore heard running footsteps behind her. She wheeled around, leveled the
firegun she'd lifted from the stunned guard, held steady a moment and then
squeezed the trigger. Fire burst from the corridor wall. The first guard ran
into the flames, then staggered away, shielding his eyes, dropping his weapon.
There were screams and curses behind him, and for a moment no one else ventured
beyond the protecting wall.
She heard the elevator whine beside her, stop, hiss open. She wheeled again,
raised the gun a second time.
Holder himself!--bearded and stained with sweat, he cursed and pounded the lift
controls, not sparing her so much as a glance.
She faltered, but wasted no time. She lifted the gun toward Holder's eyes; as
soon as the moving barrel found its target, she would squeeze the trigger.
Squeeze it she did. But just before she did she felt her cheeks sag and her
mouth suck and pop open involuntarily, and heavy eyelids come halfway down over
her eyes. Her knees buckled, and when the gun went off it wasn't pointing at
Holder at all, and the capsula burrowed under the wool
198
RE-ENTRY
RE-ENTRY
199
carpet and discharged against the deck. A sluggish pool of fire erupted at her
feet, and she didn't know if she had the strength to keep from falling into it.
The elevator, its safeties overridden by acceleration it was never designed to
withstand, had already plummeted from her sight
Holder was floating when the elevator stopped and the doors slid open, and he
caromed off the ceiling, scrabbling to get a purchase on the doors before they
closed. He pulled himself out into the hall just hi time to be thrown savagely
to the floor. He lay stunned and gasping.
Was he already too late? Reason screamed "yes" and told him to get to the
lifeboats. If Maya had caused the disaster, then the damage was already done.
But he couldn't give up now; he couldn't admit that salvation had slipped
through his grasp a second tune.
An old woman's body was lying on the floor a couple of meters away. Painfully
her head lifted, and she turned her face toward him. "/ wondered if you would
make it this far," said Clarissa Sirich, forcing the words through her ancient
sagging throat. "I must tell you..."
Holder had no time for lectures. Vividly he recalled the last moments of
Griffin, the spasms of the disintegrating vessel. Only seconds remained. He
pulled himself erect with agonizing effort and staggered past the prostrate body
of Sirich --not even hearing the words she so desperately pushed into the air, he
reeled in mock drunkenness toward that cabin, half a corridor away.
The weight lifted and everything felt normal. Holder knew it would not last, but
he took what advantage he could, sprinting down the curving corridor. Around him
sirens wailed and emergency lights flashed and the insistent voice of the
address system ordered everyone to the hangar deck.
He found Phil lying groggily on the floor. Holder knew he'd been thrown against
the far wall and wouldn't recover for another minute. By then ...
He faced the door. At forty-three Holder was fatter and shorter of breath, but
he was also stronger, more determined, and cared less about pain. He kicked at
the door with all his power. To his astonishment, it flew in without resistance.
He stepped forward. Heat and light expanded from the
recycler aperture at the far end of the little cabin. Holder got his hands in
front of his eyes just before he was bathed in flame. The force of expanding
gases slapped the door shut in bis face, saving his life; he was left with the
sharp stench of burned hair and cloth.
He grabbed at the twisted door handle, screaming in agony at its fiery touch.
The door was already melting as he pushed it open against the howling inferno
inside.
He hardly felt the hands on his shoulders, pulling him away, and in the strength
of his rage he could easily have resisted them if the dying ship had not
convulsed again, throwing him to the floor along with his would-be rescuers. He
found himself smashed into the carpet, felt its rough weave pressing into his
flesh. He was staring into Phil's crushed, horror-stricken face only centimeters
away. "Listen," Holder said, forcing his lips of putty to form the words.
"You'll survive. You'll live to come back, as I did. What you have to do is ..
.**
Then they were hurled, weightless, against the ceiling. He was tumbling in the
smoke-fouled air, and Phil was lost, and there was old Sirich floating in front
of him. "Why didn*t you listen to me?" she shouted. "Time..."
He ignored her again. "Phil, where are you, man? Fve got to tell you--**
Sirich cut through in the sharpest tones he'd ever heard from her. "Let him go!
You can not improve his life, Holder, you can only shorten it."
"Phil! For my sake--"
"You'll kill him for your sake! He must get to the hangar deck with the others,
don't you remember?"
Flames poured into the corridor, from cabins on both sides whose doors had
melted away. Fire roiled crazily around them and below them in the turbulent
currents of weightless air. Reflexively Holder retreated. "Phil!"
A faint shout came from up ahead. "This way, T.T."
Holder started to swim faster through the smoke, but Smch's hand on his shoulder
kept him back easily. "Will you let go? Will you accept your life--his life--and
live it? Or wfll you condemn yourself to this eternity of failure?"
He looked at her aged face, and then down at his blistered and charred hands. He
stared at her out of red eyes set in a face bearded with ash. He began to weep.
200
RE-ENTRY
Through the flames Angelica Claymore watched black and red silhouettes of
passengers being efficiently herded along the hangar deck toward assigned life
capsules and launches. She admired the expertise of the ship's personnel as they
kept their groups organized, rounding them up when zero-gee episodes threatened
to scatter them, helping them to keep going when explosive accelerations slapped
them to their knees. Claymore admired the ship's personnel, but she had her own
job to do--twice she'd discouraged crew members who'd looked as if they were
thinking of requisitioning the Sprint.
She sat with her back to the open airlock door, an oxygen mask damned to her
face. Her white silks were blackened and torn. Her internal monologue was a
string of expletives --she badly wanted to get aboard the Sprint and tell it to
get her out of here.
But Sirich had said she'd be waiting in the Sprint, and-- damn the old woman!--she
wasn't.
Claymore was highly intelligent, but as an activist she liked to deal in simple
emotions. She wasn't going to worry about whether Sirich was using her again. In
spite of everything she still liked Sirich, and she would guard the ship until
the old woman showed up, or until she herself was forced to
flee.
With a start Claymore recognized Ted Macklin in the flickering shadows on the
far side of the hangar deck-- Theodore Macklin, soon to be Speaker of the United
States of North America and self-proclaimed "hero" of the wreck of the Griffin--
trying to push his way to the head of a line of weeping socialites, only to be
forcibly restrained by a young officer and made to wait his turn.
How easy it would have been in that moment to add one single well-aimed firebolt
to the inferno of smoke and flames, to incinerate the panic-stricken Macklin in
his tracks! In an instant Claymore would have reversed her mission's purpose at
its causal root.
Concurrently with that shocking temptation came an even more astounding thought--
that it wouldn't make any difference! That Sirich was right, Claymore's proper
past would forever be her proper past and could not be changed either in memory
or reality. And something more as well, that without Macklin Earth would follow
the path to its self-determined perdition anyway, unless she were willing to
shoulder
RE-ENTRY
201
the intolerable burden of returning again and again to adjust each human error.
How many Doppels would she lose on each fix-it trip? How many universes would
eventually benefit from her efforts? Was she willing to play the goddess, as
Sirich had suggested?
These jarring ideas formed and dissipated in far less time than she would have
needed to express them aloud, and by the time she had disciplined her rebellious
spirit, Ted Macklin had disappeared from her view.
Finally Sirich, that nimble crone, appeared running lightly across the webbed
steel flooring, holding a mask to her face. Behind her came Holder.
At the sight of Holder the firegun twitched reflexrvely in Claymore's hand; with
him, she had to make a positive effort to counteract her self-induced
conditioning. All around her the disintegrating ship gave evidence that her
mission was complete, that Holder had been too late.
Another lurch, and a chattering vibration ran through the ship, and the very
walls began to howl. Claymore knew the end must be at hand.
They were weightless again, and Sirich and Holder were floundering. Sirich was
the luckier--her last step had aimed her precisely at the airlock, and she flew
right into it. Claymore, keeping a grip on the frame of the lock, threw away the
firegun and stretched out her hand to catch Philip Holder.
Perhaps it would be useful, she thought, to clean up all the extratemporal
debris.
Her fingers closed on his bloody, stiffened hand.
36
Once on a hot summer day Holder had been sitting on a balcony on Parnassus,
sipping a glass of wine, when he became aware of a constant popping sound almost
at the threshold of his hearing. The first thing he noticed when he started
looking for the source of the sound was that his table had
202
RE-ENTRY
been sprinkled with fine seeds, like carroway on a bun. He swept them away, and
within a minute or two more had appeared. Then he realized that the popping
sound came from the adjacent hedge, a bush with densely packed, small, hard,
shiny leaves, each branch ending in a stalk of dozens of clustered seed pods.
Under the influence of the summer sun the pods were exploding, launching the
seeds blindly outward. He wondered what fraction of this prodigal spray of life
would survive.
The Sprint stood off a few hundred kilometers as Griffin broke apart. Life
capsules and launches fled the stricken liner with little thought for their
final destination. Only a tiny proportion of the ship's solidified superhydrogen
elements had mingled--producing a series of powerful explosions that dispersed
the remainder--but the space around the ship cor-ruscated with random
interactions, spewing energetic particles in all directions.
Yellow radiation warnings glowed on the Sprint's boards. The ship's occupants
were bundled into thick radiation suits; Holder's, originally intended for the
portly Unwin, was much too large.
"There it; goes,'* said Claymore. The screens guttered with an oily mass of
flame, darkened almost to blackness by electronic filter circuits, but too
bright to be suppressed entirely. Like a film of a falling rock shown upside
down at twice the normal rate, the wreck of the Griffin fell straight up into
the void.
'Two-plus gees for almost an entire day," said Sirich. "You're there, Philip. So
is Macklin. He didn't make it to a life capsule, lucky for him, though he
probably climbed over a few children trying."
The viewscreens gradually irised open as the offending radiation diminished,
until the stars grew bright, filling the darkness like a mass of spilled
diamonds glistening with cold, eternal light
'The neighborhood's cooled off," said Claymore. "Let's get out of these." She
unstrapped herself, floated out of her couch, and began pulling her suit apart
Holder spoke for the first time since he'd been dragged aboard. "They weren't in
the cabin," he said in a voice dry as dead coals. "Maya and Kenny. They weren't
in there."
RE-ENTRY
203
"I was trying to tell you that," Sirich said, ripping open her suit
Claymore plucked the hood from the unmoving Holder's head and started helping
him with the fastenings of his suit
He blinked naked eyelids at Sirich. "When did you know? A year ago? Twenty years
ago?"
"Let's say I knew with certainty about twenty minutes ago," she said, folding
the suit and stowing it in the locker with Claymore's. "When I saw the woman
from across the corridor carry your baby toward the elevators, before you
arrived."
"Naomi," he said. He paused. "But you were already waiting for me."
Claymore briskly but carefully pulled his gloves off for him; his hands were
cracked and bloody. She carried the gloves to the cleaning receptacle,
fastidiously, with her fingertips.
"We should get you started on burn treatments right away, Philip," said Sirich,
"You'll have nasty scars."
He shook his head. "I'm thirsty," he said; then, "I want to hear the rest"
Claymore impatiently pulled a water bottle from a wall panel and held it for him
as he sucked eagerly. "You'll have to take care of yourself after this, Holder.
I'm not your nurse."
He kept sucking, and then pulled his mouth away. "Okay," he said. "I'll take
care of myself. But I want to hear."
"I want to hear too, Clarissa," Claymore said as she replaced the bottle.
"All the worlds you sought to preserve are still intact, Angelica. Your efforts
to make things come out the way they are going to come out anyway are quite as
touching as Philip's efforts to change them." Sirich looked at Holder. "Surely
you understand by now that your wife had nothing to do with the wreck of the
Griffin, Philip? And that you could not have prevented it in any case."
"The fire--"
"When I was a little girl on Earth my father told me of a great electrical power
failure he had experienced as a young man. Many cities in what was then the
United States were affected, including New York, What sticks in my mind was his
story of the little boy who had been playing with a bread toaster, against his
mother's strict orders, and who plugged in the forbidden machine at the precise
moment when the
204
RE-ENTRY
lights went out--everywhere. The little boy would never believe he was not
personally responsible."
Claymore looked at Sirich quizzically. "When did this happen, exactly?"
"Oh, before your time." Sirich bent forward from her seat and took Holder's
hands in her own, inspecting them gently. "The fire that came from the recycler
was not set by Maya's naive efforts, Philip," she said. She gave him a wan
smile. "I'm sure the machine was happily gobbling everything she was feeding it,
notably the contents of your suitcase. The jecyclers were centrally connected to
a fusion torch. Back-flash from an explosion in the annihilator must have come
through all of them at once."
"And Mayar
Sirich released his hands and leaned back. "I've studied the records of the
aftermath more carefully than either of you. There is no mention of anyone who
could have been her, either among the survivors or the known dead. In that
respect her fate is no different from half the others aboard."
An involuntary gasp escaped Holder's lips. Claymore looked at his ashen face:
fine beads of perspiration stood out on his forehead. "I'm putting you in the
infirmary, Holder, before you go into deep shock."
Sirich helped Claymore unbuckle him, and roll him out of his suit and the rest
of his clothes. He did not protest, but he repeated Kenny's name.
"His name isn't Kenny now, Philip," said Sirich as she worked. "And hi my proper
time he is as old as you are. You see, I had a premonition of danger--even in the
absence of the spectacular show you put on for us this time around, Philip--and I
managed to be on one of the first launches to get away. Just before they sealed
us in, a crewman brought a baby on with him. He said he'd found him in a dead
woman's arms. I didn't know who he was; now I do."
"He's alive--I could--"
"I'll tell you this much: he is healthy; he is more or less content. You have no
right to hope for more. No human has the right to hope for anything more, for
any other. Later I'll let you decide if you really need the details."
They finished stripping Holder naked, and then carefully arranged him inside the
Sprint's infirmary berth. The Sprint was as well equipped medically as it was
militarily; one kind of preparedness implied the other.
RE-ENTRY
205
But Holder was not ready for sleep; he kept talking even as they lowered the
cabinet's transparent lid. "You could have told me, Clarissa. You already knew
..."
"Hush. You would not have believed what I could have told you, and I did not yet
know what you wanted to know. Sleep now. We'll talk again when you get up."
The lid closed on Holder. Claymore pressed a sequence of keys on the side of the
cabinet, waiting until she saw a pattern of lights that satisfied her. The lid
grew opaque and Holder disappeared.
Claymore found Sirich in the cabin, changing into fresh work clothes. It was
uncharacteristic of her to undress so openly; Claymore noted with interest the
firm smooth muscles under the wrinkled skin. "So, Clarissa, you were
experimenting with him as well as with me?"
Sirich looked at her with surprise. "I was never experimenting with you,
Angelica--you were the means of the experiment, not the subject of it." She
zipped up her coveralls. "I planted enough hints to scare Mr. Speaker Theodore
Macklin into sending someone after Holder when he jumped the Humboldt, and I
knew exactly how to do it; though I didn't know that the someone he sent would
be you. You are an accident, Angelica, but I rather like you. In that respect,
you are to me what a daughter might have been."
"How should I take that?" Claymore asked coolly, as she began to change her own
clothes.
'Take it this way." Sirich reached out to the young woman, took her by the
shoulder, kissed her on the cheek. For an instant she held her close, then let
go. "I like you, despite the words I used when I was trying to free you from
yourself. If I weren't such a cynic, I might say I've grown to love you."
Claymore looked away, her throat tense. "How do I know, this time ..."
'1 was telling the truth that time, too. I like you anyway."
Angelica Claymore yanked her jacket closed and settled into the pilot's seat,
drawing the straps across her chest like armor. The boards displayed the
Sprint's status--fueled, provisioned, sealed, ready for any assignment "What now,
old woman?" she said gruffly.
Sirich laughed. "You can't insult me with the facts, daughter." She slipped into
the right-hand seat and buckled herself in. "The choice is yours: all of time is
opened before you. Past and present are one, of course, minor variations on a
206
RE-ENTRY
RE-ENTRY
207
theme--you've seen that for yourself. Would you like to go straight home to
Earth? There you're a girl of, what, ten years?"
Claymore did not reply immediately. "If I could, I would change things," she
said at last. "Like Holder wanted to. But it can't be done--that was your
experiment, wasn't it? That's what you proved."
"It's true I helped him make a determined assault on history. Let's say the
outcome supported the predictions of theory. If you want to throw your life on
the roulette wheel, there's room for a small change or two...."
"Not enough. Small changes are not enough." Claymore studied the instruments,
feeling with her mind for the patterns of potential they encoded. "What about
the future?"
"The future!" Sirich laughed with scorn. "Certainly, nothing is easier! But
you'll find the future very dull in this neighborhood." Sirich looked at the
starry skies pictured in the view-screens : unseen in those wide-angle views
were the fleeing life boats--those that would disappear forever, those that would
survive to reappear in some distant place and time. Sirich resumed talking; she
was subdued. "We were early away. In our eagerness to escape we depleted our
fuel supply, and at a crucial moment our engines failed. We brushed the holes,
and emerged a thousand years into the future--"
"A thousand years!"
"And Darwin had not changed! In a thousand years not one man or woman of vision
will arise to grasp the essential nature of what I sought to do there. I wanted
to understand the nature of transformation; they were content--all of them, for a
thousand years!--to celebrate the past. Tame dinosaurs!" She looked at Claymore
then, and Claymore saw that the old woman's eyes were bright. "They wrote books
about me!" said Sirich. "They made statues of me! But they knew less of me than
you do."
Claymore looked away, unable to bear the woman's intense, demanding gaze.
"Perhaps we should let Holder vote," she said. "After all, it's for his sake
that we're here."
"I already know his vote," Sirich said. "Would you like me to tell it to you?"
I watched you emerge from your.cocoon, the palms of your hands fresh and pink,
your skin all clear and brown as a baby's, and I thought to myself, "Here is a
new man come
forth into the world, purged and cleansed by the fires of experience, ready to
live ..."
Of course I should have known you better. "You used me," you said. Those were
your first words. Oh Philip, I wanted to cry, I wanted to laugh, I wanted to hit
you! But I explained things to you instead.
I told you of my work in Special Projects, so far behind me now in my proper
time--that after a century of study and experiment I was on the edge of
describing mathematical parameters for the evolutionary potential of the human
organism. I had calculated theoretical limits to what could be learned from
detailed analyses of the structure and function of the brain, I had estimated
the boundaries of ignorance inherent in statistical treatments of social
behavior--utility matrices, game theories, and so on--and I had at last accepted
the essential poverty of that behavioral pseudo-genetics once so quaintly known
as "sociobiology." You might say I was trying to get the animal nature of people
to precipitate out in a lump of numbers; the volatile stuff that remained would,
I hoped, be refined humanity.
Then the wreck of the Griffin intervened, and I was confronted with the futility
of my efforts. A thousand years had passed; the human race had caught the social
and spiritual paralysis of functional immortality. I'd tried to isolate it, in
myself--they thanked me for failing.
Biology lost its charms (1 saw nothing left in the science but to amuse oneself
creating monsters), so I drifted off into the cold and--as I thought--impractical
realms of cosmology. There, to my surprise, I found new hope.
Remember, Philip, how we spoke of the world as an infinitely deep ocean, layered
with thin horizontal currents flowing this way and that? And how the little sea
creature? that live in these universe-currents go jostling through their lives
unaware of their infinite one-to-one counterparts, all of whom are doing exactly
the same thing at the same time? You were the bold little diatom (you and all
your Doppels) who submerged himself and lingered a while in a backward flowing
current, to re-emerge in your counterpart's universe before he had left it...
Well, I was bold before you, Philip, and I shall go on being bold long after
your thin shell of lime has dissolved. I and all my Doppelgangers are stones
falling into the deep. Each eternity is a moment to me, and my only hope of
change lies in
208
RE-ENTRY
sampling as many alternative forevers as I can. So I will go as far down into
the infinite ocean of universes as I can, in the only direction I can, until
every last version of me has been crushed out of existence by the pressure of
change.
Space is a resonant cavity of possibilities, Philip, and the universes are
standing waves, phasing, reinforcing, abrading each other into identity--but
there is leakage; way out there near the edges there is change.
In measuring myself against survivable change I hope to grasp again the nature
of human nature. Yes, I used you in this experiment, but I helped you too; when
I came back from the thousand-year reign to my ur-home on Earth I found a man
determined to remake his life. I gave you certain tools, and with them you have
helped me test my still crude and tentative model; you have given me both
negative and positive evidence to work with.
You have confirmed that curiosity is needed; and tolerance for incomplete or
ambiguous answers (the stumbling block of att religions); coupled with
persistence, and determination to discover the truth. But equally necessary--and
here you excel--is an obsession for doing things until you either get them right
or something new pops out.
What I have described are the conditions of creation. The determination to
create is the essence of humanity, and it now appears that to preserve humanity
it will be necessary to circumvent the dead, deterministic hand of the cosmos
itself. On some scale, perhaps, that has always been true.
Well, your would-be assassin and I have decided to join forces and go off
universe-hunting. We're dropping you off where you said you'd like to go;
perhaps one of these days we'll pop back in and check up on your progress...
Re-entry: Earth, 206 NI.
Experience remains, of course, the sole criterion
of the physical utility of a mathematical construction.
But the creative principle resides in mathematics.
In a certain sense, therefore, I hold it true that pure
thought can grasp reality, as the ancients dreamed.
--Albert Einstein, On the method
of theoretical physics
"You can be as ruthless as any goddess, but you're not ominscient. Unwin has
betrayed you, as you had hoped--and he's betrayed me too, though I will manage,
by sheer good luck and quick thinking, to survive that bit of trickery on my
own. I never did like that man.
"I write in the confidence (which you gave me) that causality can not be
violated, because it does not exist across the boundaries of the universes, only
within them. You claim there are no loops in space-time, only spirals. Well,
you're the theorist, not me. But thermodynamics works always and everywhere, and
I'm not above trying to insure that things come out all right for the me who
just left here, as well as they did for me who got back here a couple of years
ago and has been hiding out in that absurd think tank. I wouldn't mind seeing
you make things hot for that S.O.B. Unwin, as long as you don't do anything
drastic.
"I know I'm cheating, telling you Fm back and alive--you were always so careful
not to spoil the fun for your selves and other friends. I, on the other hand,
have always been something of a spoiler. This far I'll tantalize you--I'll tell
you I got almost everything a human has a right to hope for. Thanks to you.
"I love you, you thousand-year-old hag." (unsigned)
Holder punched the send key of the public terminal, then walked along the inner
balcony of the soleri toward the familiar apartment door.
Susan heard the buzzer. "Who is it?" she said. The screen showed only the
balcony outside, people passing to and fro in silence.
"You'll recognize my voice," said the speaker. "Don't use my name."
211
212
RE-ENTRY
She did recognize the voice, but she didn't believe it. She pushed the key that
let whoever was out there see her face. "Is that really you?" she said
suspiciously. "How can you be here, Ph--"
"Please!" he said. "I'm not that man." He stepped into the camera's view. He
looked made-over, as if he were just back from a long vacation--or a short stay
in the hospital. "I'm not the man you think I am."
She stared at him for a long time, i(You couldn't be, could you? We heard you
disappeared two days ago. You would have had to get back here almost as fast as
light And that's impossible,"
"I'm glad you understand." He paused. "Are you afraid of me?"
She nodded. She looked away from the screen. She felt cold, and hugged herself.
"Will you meet me someplace? In public? How about Alejandro's, say in five
minutes--I'll buy you a drink."
"He drank," she said.
"I don't. Not like that"
She thought about it, hut she'd known he would ask, and she'd known her answer,
as soon as she saw his face. "I'm a curious fool, but okay. What should I call
you?"
"I'm with the FRAME Corporation. My name is--now don't laugh--"
But she laughed anyway.
Many nights later she moved against him in the darkness of her room. "I believe
you now. You're not the same man at all."
About the Author
Paul Preuss is an independent producer of films and television programs, as well
as a writer, director and editor. He has been editor and associate producer of
Emmy and Christopher award-winning television specials. Besides producing a
number of national award-winning science documentaries, he has written articles
on science fact for magazines such as SCIENCE 80 and HUMAN BEHAVIOR. Mr. Preuss
resides in San Francisco with his wife Karen, a freelance photographer.